View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk66-7 (Length: 292)

Name: R108-tnk66-7
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk66-7
R108-tnk66-7
[»] chr2 (3 HSPs)
chr2 (1-292)||(28437180-28437471)
chr2 (12-186)||(28487019-28487190)
chr2 (103-186)||(28465340-28465423)


Alignment Details
Target: chr2 (Bit Score: 288; Significance: 1e-161; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 1 - 292
Target Start/End: Original strand, 28437180 - 28437471
Alignment:
1 gatggatcgtggcaaagacaataccagaaaacatttgtttaaattctacatttaacaatggtcaaagtatttgtgggttgaatagcaattgtacccttag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28437180 gatggatcgtggcaaagacaataccagaaaacatttgtttaaattctacatttaacaatggtcaaagtatttgtgggttgaatagcaattgtacccttag 28437279  T
101 agatgaccaaaggccaatgtgtacttgtctagaaggatattctctaattgattcaaacaacatgtatggggattgcataccaaattcccaaatgaagaaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28437280 agatgaccaaaggccaatgtgtacttgtctagaaggatattctctaattgattcaaacaacatgtatggggattgcataccaaattcccaaatgaagaaa 28437379  T
201 attgattctccatcacctctctccaatttgaaggaagatcatgatgataaaaccaaaaagagaaaaggtcatgatactttgatcattttgat 292  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
28437380 attgattctccatcacctctctccaatttgaaggaagatcacgatgataaaaccaaaaagagaaaaggtcatgatactttgatcattttgat 28437471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 12 - 186
Target Start/End: Original strand, 28487019 - 28487190
Alignment:
12 gcaaagacaataccagaaaacatttgtttaaattctacatttaacaatggtcaaagtatttgtgggttgaatagcaattgtacccttagagatgaccaaa 111  Q
    |||||||| |||||||||||||| |||||  ||||||||||   |   ||| || || | |||||||| ||||| | ||| ||| ||| | |||||||||    
28487019 gcaaagactataccagaaaacatatgtttgtattctacatt---ccgaggtgaaggtgtatgtgggtttaatagtatttgcaccattacaaatgaccaaa 28487115  T
112 ggccaatgtgtacttgtctagaaggatattctctaattgattcaaacaacatgtatggggattgcataccaaatt 186  Q
    ||||||  ||||| || | ||| | |||||| |  ||||||||||| ||||||||||  | ||||||||||||||    
28487116 ggccaaattgtacctgcccagacgaatattcaccgattgattcaaataacatgtatgctggttgcataccaaatt 28487190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 103 - 186
Target Start/End: Original strand, 28465340 - 28465423
Alignment:
103 atgaccaaaggccaatgtgtacttgtctagaaggatattctctaattgattcaaacaacatgtatggggattgcataccaaatt 186  Q
    |||||||||||||||  ||||| || | ||| | ||||||||  ||||||||||| ||||||||||  | ||||||||||||||    
28465340 atgaccaaaggccaaattgtacctgcccagacgaatattctccgattgattcaaataacatgtatgctggttgcataccaaatt 28465423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175991 times since January 2019
Visitors: 1577