View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk75-1 (Length: 374)

Name: R108-tnk75-1
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk75-1
R108-tnk75-1
[»] scaffold0474 (1 HSPs)
scaffold0474 (1-206)||(10304-10509)
[»] chr1 (29 HSPs)
chr1 (137-345)||(13785633-13785839)
chr1 (162-368)||(10115503-10115705)
chr1 (134-269)||(32260739-32260874)
chr1 (134-346)||(11693551-11693760)
chr1 (219-344)||(14352747-14352870)
chr1 (141-210)||(2949736-2949805)
chr1 (141-210)||(4131803-4131872)
chr1 (141-210)||(9459934-9460003)
chr1 (141-210)||(9463761-9463830)
chr1 (141-210)||(15295360-15295429)
chr1 (141-210)||(17325148-17325217)
chr1 (141-210)||(39931772-39931841)
chr1 (141-210)||(46432557-46432626)
chr1 (141-210)||(47905966-47906035)
chr1 (141-210)||(48664862-48664931)
chr1 (141-210)||(6997224-6997293)
chr1 (141-206)||(24325357-24325422)
chr1 (141-210)||(31736036-31736105)
chr1 (145-210)||(45693945-45694010)
chr1 (147-210)||(6115638-6115701)
chr1 (145-210)||(16561145-16561210)
chr1 (141-210)||(27339651-27339720)
chr1 (141-210)||(28998765-28998834)
chr1 (141-210)||(29004481-29004550)
chr1 (141-210)||(27337453-27337522)
chr1 (168-210)||(21948704-21948746)
chr1 (134-173)||(14352422-14352461)
chr1 (291-345)||(32260883-32260937)
chr1 (169-210)||(6996067-6996108)
[»] chr7 (39 HSPs)
chr7 (134-353)||(12310405-12310622)
chr7 (134-210)||(10690677-10690752)
chr7 (141-210)||(443336-443405)
chr7 (141-210)||(1849675-1849744)
chr7 (141-210)||(3035425-3035494)
chr7 (141-210)||(7092689-7092758)
chr7 (141-210)||(7094936-7095005)
chr7 (141-210)||(7472495-7472564)
chr7 (141-210)||(11756935-11757004)
chr7 (141-210)||(18345247-18345316)
chr7 (141-210)||(20625744-20625813)
chr7 (141-210)||(20629635-20629704)
chr7 (141-210)||(20642054-20642123)
chr7 (141-210)||(24258168-24258237)
chr7 (141-210)||(37412637-37412706)
chr7 (140-210)||(21470804-21470874)
chr7 (141-206)||(1606181-1606246)
chr7 (141-210)||(3677007-3677076)
chr7 (141-210)||(20299165-20299234)
chr7 (145-210)||(28485275-28485340)
chr7 (141-210)||(28487259-28487328)
chr7 (141-210)||(38395996-38396065)
chr7 (141-210)||(47865338-47865407)
chr7 (141-210)||(40281911-40281982)
chr7 (165-267)||(12484984-12485087)
chr7 (165-267)||(12506415-12506518)
chr7 (165-267)||(12657608-12657711)
chr7 (141-207)||(21989863-21989929)
chr7 (141-206)||(7349792-7349857)
chr7 (141-206)||(7352171-7352236)
chr7 (141-210)||(7470542-7470611)
chr7 (141-206)||(31156425-31156490)
chr7 (141-210)||(42331514-42331583)
chr7 (282-368)||(40281741-40281828)
chr7 (148-210)||(38393700-38393762)
chr7 (165-241)||(6628840-6628917)
chr7 (282-317)||(10690811-10690846)
chr7 (141-191)||(20297108-20297158)
chr7 (282-330)||(40281810-40281858)
[»] chr2 (22 HSPs)
chr2 (134-368)||(41304748-41304971)
chr2 (134-368)||(15693576-15693808)
chr2 (134-348)||(39286881-39287089)
chr2 (135-269)||(41303494-41303629)
chr2 (134-206)||(28568339-28568411)
chr2 (141-210)||(35216105-35216174)
chr2 (141-210)||(35218486-35218555)
chr2 (134-210)||(28568671-28568747)
chr2 (141-210)||(27136426-27136495)
chr2 (141-210)||(27583828-27583897)
chr2 (141-210)||(42452459-42452528)
chr2 (141-210)||(42924015-42924084)
chr2 (141-209)||(23452751-23452819)
chr2 (141-210)||(34575624-34575693)
chr2 (282-368)||(27583690-27583775)
chr2 (134-191)||(7502572-7502629)
chr2 (284-368)||(7502691-7502777)
chr2 (284-354)||(34575519-34575588)
chr2 (134-212)||(26345387-26345463)
chr2 (134-163)||(10942981-10943010)
chr2 (134-163)||(10948850-10948879)
chr2 (284-368)||(28568534-28568616)
[»] chr6 (14 HSPs)
chr6 (134-342)||(30443015-30443221)
chr6 (134-345)||(30445222-30445433)
chr6 (141-210)||(2629400-2629469)
chr6 (141-210)||(30035117-30035186)
chr6 (141-209)||(20526556-20526624)
chr6 (141-210)||(5275849-5275918)
chr6 (141-210)||(18317761-18317830)
chr6 (141-210)||(19705086-19705155)
chr6 (141-206)||(12196029-12196094)
chr6 (141-210)||(22858457-22858526)
chr6 (141-206)||(26933083-26933148)
chr6 (141-210)||(30966933-30967002)
chr6 (134-188)||(12158521-12158575)
chr6 (141-189)||(17011789-17011837)
[»] chr8 (13 HSPs)
chr8 (134-303)||(13986215-13986381)
chr8 (141-210)||(3265673-3265742)
chr8 (141-210)||(3873760-3873829)
chr8 (141-210)||(15808972-15809041)
chr8 (141-210)||(32339104-32339173)
chr8 (141-210)||(43529881-43529950)
chr8 (141-209)||(41382429-41382497)
chr8 (143-210)||(608482-608549)
chr8 (218-347)||(11701333-11701457)
chr8 (141-210)||(28283734-28283803)
chr8 (141-209)||(41384503-41384571)
chr8 (134-210)||(30679188-30679263)
chr8 (135-185)||(11701435-11701485)
[»] chr4 (24 HSPs)
chr4 (137-240)||(38209160-38209263)
chr4 (134-269)||(29609859-29609994)
chr4 (134-333)||(54929077-54929274)
chr4 (141-210)||(22135140-22135209)
chr4 (141-210)||(24347969-24348038)
chr4 (141-210)||(56030199-56030268)
chr4 (141-208)||(38890624-38890691)
chr4 (165-335)||(10979613-10979780)
chr4 (141-210)||(5100753-5100822)
chr4 (141-210)||(14787942-14788011)
chr4 (145-210)||(22132908-22132973)
chr4 (141-210)||(47211229-47211298)
chr4 (134-333)||(5516653-5516846)
chr4 (141-202)||(14789500-14789561)
chr4 (141-206)||(44600353-44600418)
chr4 (145-209)||(9022074-9022138)
chr4 (148-210)||(17662747-17662809)
chr4 (141-210)||(9863509-9863578)
chr4 (147-206)||(30136331-30136390)
chr4 (163-241)||(32274322-32274398)
chr4 (141-209)||(19322418-19322487)
chr4 (284-334)||(38209080-38209131)
chr4 (284-328)||(9022193-9022237)
chr4 (141-210)||(10112636-10112701)
[»] chr3 (21 HSPs)
chr3 (134-231)||(53974107-53974204)
chr3 (134-238)||(11072637-11072741)
chr3 (135-342)||(11066249-11066455)
chr3 (141-210)||(51943052-51943121)
chr3 (141-210)||(746432-746501)
chr3 (141-210)||(41848814-41848883)
chr3 (141-210)||(42991963-42992032)
chr3 (141-210)||(53918171-53918240)
chr3 (141-209)||(25533117-25533185)
chr3 (165-303)||(54287489-54287625)
chr3 (141-210)||(455583-455652)
chr3 (141-210)||(457960-458029)
chr3 (141-210)||(1313092-1313161)
chr3 (141-206)||(10622052-10622117)
chr3 (141-210)||(53916003-53916072)
chr3 (141-205)||(4104409-4104473)
chr3 (141-205)||(6561623-6561687)
chr3 (141-209)||(42989962-42990030)
chr3 (147-210)||(27636133-27636196)
chr3 (177-241)||(12019168-12019233)
chr3 (284-316)||(41848938-41848970)
[»] chr5 (23 HSPs)
chr5 (134-210)||(5779148-5779224)
chr5 (141-209)||(17415822-17415890)
chr5 (141-210)||(18511723-18511792)
chr5 (141-210)||(18596336-18596405)
chr5 (141-210)||(25803717-25803786)
chr5 (141-210)||(27912229-27912298)
chr5 (141-206)||(15551935-15552000)
chr5 (141-210)||(18468708-18468777)
chr5 (141-210)||(26097431-26097500)
chr5 (141-210)||(26098762-26098831)
chr5 (141-210)||(27910145-27910214)
chr5 (141-210)||(40221292-40221361)
chr5 (141-206)||(3373555-3373620)
chr5 (141-210)||(6661954-6662023)
chr5 (141-210)||(18509828-18509897)
chr5 (143-210)||(21288541-21288608)
chr5 (284-353)||(5779040-5779112)
chr5 (218-368)||(32520231-32520381)
chr5 (151-210)||(10586549-10586608)
chr5 (134-185)||(32520202-32520253)
chr5 (218-328)||(15143252-15143360)
chr5 (141-185)||(15143230-15143274)
chr5 (141-185)||(18466421-18466465)
[»] scaffold1674 (1 HSPs)
scaffold1674 (141-210)||(16-85)
[»] scaffold0468 (1 HSPs)
scaffold0468 (141-210)||(2106-2175)
[»] scaffold0008 (1 HSPs)
scaffold0008 (134-305)||(57834-58002)
[»] scaffold0511 (1 HSPs)
scaffold0511 (141-210)||(1745-1814)
[»] scaffold0133 (1 HSPs)
scaffold0133 (143-208)||(4558-4623)
[»] scaffold0005 (2 HSPs)
scaffold0005 (141-210)||(51719-51788)
scaffold0005 (141-202)||(50169-50230)
[»] scaffold0154 (1 HSPs)
scaffold0154 (145-210)||(11982-12047)
[»] scaffold0031 (1 HSPs)
scaffold0031 (141-209)||(78893-78961)
[»] scaffold0533 (1 HSPs)
scaffold0533 (178-241)||(2199-2263)


Alignment Details
Target: scaffold0474 (Bit Score: 179; Significance: 2e-96; HSPs: 1)
Name: scaffold0474
Description:

Target: scaffold0474; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 10304 - 10509
Alignment:
1 ggtacctttaaaccatcgtcaacatcaacaagtttgaagctatctacacacttccctttttcaactcatcaataattcaactagttatatcgaaggttgt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||    
10304 ggtacctttaaaccatcgtcaacatcaacaagtttgaagctatctacacacttcc-tttttcaactcatcaataattcaactagttatatcgaagattgt 10402  T
101 ggagcatttgattttctctccattgttgtcctcttgaaattgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatat-gtttca 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||  |||||    
10403 ggagcatttgattttctctccattgttgtcctcttgaaattgactcaaaatttgatggataaaaaagattgttgttaaaaatataaaagatatattttca 10502  T
200 aatatat 206  Q
    |||||||    
10503 aatatat 10509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 97; Significance: 1e-47; HSPs: 29)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 137 - 345
Target Start/End: Complemental strand, 13785839 - 13785633
Alignment:
137 aaattgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttgcgattctagaagattgttgctaaaaa 236  Q
    |||||||||||||| |||||||||| | || ||||| | ||||||||| |||||| |||||||||||||||||| | |||||||| ||||||||| ||||    
13785839 aaattgactcaaaaattgatggatggagaatattgtcgctaaaaatatgaaagatttgtttcaaatatattttgtgtttctagaatattgttgctgaaaa 13785740  T
237 tatatccatgaatagtaaatgtatttttgtacccgaatgaagaagatatttgatgcaaatatatttttaaaaggaatatttgaaacaaatatattttgca 336  Q
    |||||  ||  ||||||||| ||||||||||  || |||||| | | ||||||||||||||||||||||||||||||||||||  ||||||||||||||     
13785739 tatatttatagatagtaaatatatttttgta-tcgtatgaagga-agatttgatgcaaatatatttttaaaaggaatatttgatgcaaatatattttgcg 13785642  T
337 ctgaaggag 345  Q
    |||||||||    
13785641 ctgaaggag 13785633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 162 - 368
Target Start/End: Original strand, 10115503 - 10115705
Alignment:
162 aaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttgcgattctagaagattgttgctaaaaatatatccatgaatagtaaatgtatt 261  Q
    ||||| |||||||||||||||||||||||| |||||||||||||||||| | ||| | |||||||||| | |||||||||  ||| | | |||||  |||    
10115503 aaaaaaattgttgttaaaaatataaaagatttgtttcaaatatattttgtgcttccataagattgttgttgaaaatatatttatggacaataaat--att 10115600  T
262 tttgtacccgaatgaagaagatatttgatgcaaatatatttttaaaaggaatatttgaaacaaatatattttgcactgaaggagaaagaaaagacgtatc 361  Q
    ||| | |||| |||||| | |||||||||||||||||||||||||| |||||||||||  ||||||| |||||||||||| ||| || |||| || ||||    
10115601 tttat-cccgtatgaagga-atatttgatgcaaatatatttttaaacggaatatttgatgcaaatattttttgcactgaatgaggaaaaaaaaacatatc 10115698  T
362 ttcagcg 368  Q
    |||||||    
10115699 ttcagcg 10115705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 134 - 269
Target Start/End: Original strand, 32260739 - 32260874
Alignment:
134 ttgaaattgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttgcgattctagaagattgttgctaa 233  Q
    |||||||||||||||||||||||||||||| |||||||||| |||||||||||||||  ||||| |||||||||||| | ||  |||||||||||||| |    
32260739 ttgaaattgactcaaaatttgatggatgaagaagattgttgctaaaaatataaaagaattgtttaaaatatattttgtgttttcagaagattgttgctga 32260838  T
234 aaatatatccatgaatagtaaatgtatttttgtacc 269  Q
    ||||||||  ||||| | ||||| ||||||||||||    
32260839 aaatatatttatgaacaataaatatatttttgtacc 32260874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 134 - 346
Target Start/End: Complemental strand, 11693760 - 11693551
Alignment:
134 ttgaaattgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttgcgattctagaagattgttgctaa 233  Q
    |||||||||||||||||||||||||||||| |||||| ||| ||||| |||||||  | ||||| |||||||||| | | ||  | |||||||||||| |    
11693760 ttgaaattgactcaaaatttgatggatgaagaagattattgctaaaattataaaaattttgttttaaatatatttcgtgctttcaaaagattgttgctga 11693661  T
234 aaatatatccatgaatagtaaatgtatttttgtacccgaatgaagaagatatttgatgcaaatatatttttaaaaggaatatttgaaacaaatatatttt 333  Q
    ||||||||  ||| | | ||||| |||||||||| ||| |||||| | | |||||||||||||||||||||||| ||||||||  |  ||||||| ||||    
11693660 aaatatatttatggacaataaatatatttttgta-ccgtatgaagga-agatttgatgcaaatatatttttaaagggaatattcaatgcaaatat-tttt 11693564  T
334 gcactgaaggaga 346  Q
    || ||||||||||    
11693563 gcgctgaaggaga 11693551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 219 - 344
Target Start/End: Original strand, 14352747 - 14352870
Alignment:
219 gaagattgttgctaaaaatatatccatgaatagtaaatgtatttttgtacccgaatgaagaagatatttgatgcaaatatatttttaaaaggaatatttg 318  Q
    ||||||||||| | |||||||||  ||||||||||||| |||||||||||| | |||||| | | |||||||||||||||||||||||| ||||||||||    
14352747 gaagattgttgttgaaaatatatttatgaatagtaaatatatttttgtacc-gtatgaagga-agatttgatgcaaatatatttttaaagggaatatttg 14352844  T
319 aaacaaatatattttgcactgaagga 344  Q
    |  ||||||||||||||  |||||||    
14352845 atgcaaatatattttgcgttgaagga 14352870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 2949805 - 2949736
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||| ||||||||| || ||||||| |||||||||||||||| ||||||||||||||||||    
2949805 tgactcaaaatttcatggatgaagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 2949736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 4131872 - 4131803
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
4131872 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 4131803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 9460003 - 9459934
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
9460003 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 9459934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 9463830 - 9463761
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
9463830 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 9463761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 15295429 - 15295360
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||| ||| || ||||||| |||||||||||||||| ||||||||||||||||||    
15295429 tgactcaaaatttgatggaagaagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 15295360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 17325217 - 17325148
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
17325217 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 17325148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 39931772 - 39931841
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
39931772 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 39931841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 46432626 - 46432557
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
46432626 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 46432557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 47905966 - 47906035
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
47905966 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 47906035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 48664862 - 48664931
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
48664862 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 48664931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 6997224 - 6997293
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||| ||| |||||||||||||||| ||||||||||||||||||    
6997224 tgactcaaaatttgatggatggagaatattattgctaaaaatataaaagatttgtttcaaatatattttg 6997293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 206
Target Start/End: Original strand, 24325357 - 24325422
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatat 206  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||    
24325357 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatat 24325422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 31736105 - 31736036
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||| | | || ||||||| |||||||||||||||| ||||||||||||||||||    
31736105 tgactcaaaatttgatggaaggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 31736036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 145 - 210
Target Start/End: Complemental strand, 45694010 - 45693945
Alignment:
145 tcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
45694010 tcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 45693945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 147 - 210
Target Start/End: Complemental strand, 6115701 - 6115638
Alignment:
147 aaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
6115701 aaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 6115638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 145 - 210
Target Start/End: Original strand, 16561145 - 16561210
Alignment:
145 tcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    |||||||||| |||||||| || ||||||| ||||||||||||| || ||||||||||||||||||    
16561145 tcaaaatttgttggatgaagaatattgttgctaaaaatataaaatatttgtttcaaatatattttg 16561210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 27339720 - 27339651
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    |||||| |||||||| ||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
27339720 tgactccaaatttgacggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 27339651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 28998834 - 28998765
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| ||||| |||||||||| ||||| ||||||||||||    
28998834 tgactcaaaatttgatggatggagaatattgttgctaaaactataaaagatttgtttaaaatatattttg 28998765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 29004550 - 29004481
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| ||||| |||||||||| ||||| ||||||||||||    
29004550 tgactcaaaatttgatggatggagaatattgttgctaaaactataaaagatttgtttaaaatatattttg 29004481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 27337522 - 27337453
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    |||||| ||||||||||||||   || ||||||| |||||||||| ||||| ||||||||||||||||||    
27337522 tgactccaaatttgatggatggggaatattgttgctaaaaatatataagatttgtttcaaatatattttg 27337453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 168 - 210
Target Start/End: Complemental strand, 21948746 - 21948704
Alignment:
168 attgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||| |||||||||||||||| ||||||||||||||||||    
21948746 attgttgctaaaaatataaaagatttgtttcaaatatattttg 21948704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 134 - 173
Target Start/End: Original strand, 14352422 - 14352461
Alignment:
134 ttgaaattgactcaaaatttgatggatgaaaaagattgtt 173  Q
    |||||||||||| ||||||||||||||||| |||||||||    
14352422 ttgaaattgacttaaaatttgatggatgaagaagattgtt 14352461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 291 - 345
Target Start/End: Original strand, 32260883 - 32260937
Alignment:
291 gcaaatatatttttaaaaggaatatttgaaacaaatatattttgcactgaaggag 345  Q
    |||||||||| |||||| |||||||||||  |||||||||||||||  |||||||    
32260883 gcaaatatatatttaaagggaatatttgatgcaaatatattttgcatcgaaggag 32260937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 169 - 210
Target Start/End: Original strand, 6996067 - 6996108
Alignment:
169 ttgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    |||||| |||||||||||||||  ||||||||||||||||||    
6996067 ttgttgctaaaaatataaaagacttgtttcaaatatattttg 6996108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 88; Significance: 3e-42; HSPs: 39)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 134 - 353
Target Start/End: Complemental strand, 12310622 - 12310405
Alignment:
134 ttgaaattgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttgcgattctagaagattgttgctaa 233  Q
    |||||||| |||  |||||| ||||||||| |||||||||| ||   ||||||||||| |||||||||||||||||| | |||||||||||||||||| |    
12310622 ttgaaattaactttaaatttaatggatgaagaagattgttgctactgatataaaagatttgtttcaaatatattttgtgcttctagaagattgttgctga 12310523  T
234 aaatatatccatgaatagtaaatgtatttttgtacccgaatgaagaagatatttgatgcaaatatatttttaaaaggaatatttgaaacaaatatatttt 333  Q
    || ||||   | | | ||| ||| |||||||||||| | |||||| | | |||||||| |||||||||||||||||||||||||||  ||||||||||||    
12310522 aattatacttaaggacagttaatatatttttgtacc-gtatgaagga-agatttgatgtaaatatatttttaaaaggaatatttgatgcaaatatatttt 12310425  T
334 gcactgaaggagaaagaaaa 353  Q
    ||||| ||||||||||||||    
12310424 gcactaaaggagaaagaaaa 12310405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 134 - 210
Target Start/End: Original strand, 10690677 - 10690752
Alignment:
134 ttgaaattgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    |||||||||||||||||||||||||| | | |||||||||| |||||||||||||| ||||||||||||||||||||    
10690677 ttgaaattgactcaaaatttgatggagggagaagattgttgctaaaaatataaaag-tatgtttcaaatatattttg 10690752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 443336 - 443405
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
443336 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 443405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 1849675 - 1849744
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||| ||| || ||||||| |||||||||||||||| ||||||||||||||||||    
1849675 tgactcaaaatttgatggaagaagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 1849744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 3035425 - 3035494
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
3035425 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 3035494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 7092758 - 7092689
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
7092758 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 7092689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 7095005 - 7094936
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
7095005 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 7094936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 7472564 - 7472495
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
7472564 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 7472495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 11756935 - 11757004
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
11756935 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 11757004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 18345247 - 18345316
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
18345247 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 18345316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 20625744 - 20625813
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
20625744 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 20625813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 20629635 - 20629704
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
20629635 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 20629704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 20642054 - 20642123
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
20642054 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 20642123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 24258168 - 24258237
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||| ||| || ||||||| |||||||||||||||| ||||||||||||||||||    
24258168 tgactcaaaatttgatggaagaagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 24258237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 37412706 - 37412637
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
37412706 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 37412637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 140 - 210
Target Start/End: Complemental strand, 21470874 - 21470804
Alignment:
140 ttgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||| |||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
21470874 ttgactccaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 21470804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 206
Target Start/End: Original strand, 1606181 - 1606246
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatat 206  Q
    ||||||||||||||||||| ||| || ||||||| |||||||||||||||| ||||||||||||||    
1606181 tgactcaaaatttgatggaagaagaatattgttgctaaaaatataaaagatttgtttcaaatatat 1606246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 3677007 - 3677076
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    |||||||||||||||| |||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
3677007 tgactcaaaatttgatagatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 3677076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 20299165 - 20299234
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| | ||||||||||||||||    
20299165 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttatttcaaatatattttg 20299234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 145 - 210
Target Start/End: Original strand, 28485275 - 28485340
Alignment:
145 tcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||| || ||||||| ||||||||||||| || ||||||||||||||||||    
28485275 tcaaaatttgatggatgaagaatattgttgctaaaaatataaaatatttgtttcaaatatattttg 28485340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 28487259 - 28487328
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| || |||||||||||||||    
28487259 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgcttcaaatatattttg 28487328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 38395996 - 38396065
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    |||||| |||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
38395996 tgactccaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 38396065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 47865338 - 47865407
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    |||||| |||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
47865338 tgactccaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 47865407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 40281982 - 40281911
Alignment:
141 tgactcaaaatttgatggatgaaaaaga--ttgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||||| ||||  |||||| ||||||||||||| || ||||||||||||||||||    
40281982 tgactcaaaatttgatggatgaagaagaatttgttgctaaaaatataaaatatttgtttcaaatatattttg 40281911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 165 - 267
Target Start/End: Complemental strand, 12485087 - 12484984
Alignment:
165 aagattgttgttaaaaatataaaagatatgtttcaaatatattt-tgcgattctagaagattgttgctaaaaatatatccatgaatagtaaatgtatttt 263  Q
    |||||||||||  |||||||||||||| |||||||||||||||| || | ||| || ||||||||||| |||||||||  ||| |||| |||| ||||||    
12485087 aagattgttgtagaaaatataaaagatttgtttcaaatatatttgtgtgcttcaaggagattgttgctgaaaatatatttatggatagcaaatatatttt 12484988  T
264 tgta 267  Q
    ||||    
12484987 tgta 12484984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 165 - 267
Target Start/End: Complemental strand, 12506518 - 12506415
Alignment:
165 aagattgttgttaaaaatataaaagatatgtttcaaatatattt-tgcgattctagaagattgttgctaaaaatatatccatgaatagtaaatgtatttt 263  Q
    |||||||||||  |||||||||||||| |||||||||||||||| || | ||| || ||||||||||| |||||||||  ||| |||| |||| ||||||    
12506518 aagattgttgtagaaaatataaaagatttgtttcaaatatatttgtgtgcttcaaggagattgttgctgaaaatatatttatggatagcaaatatatttt 12506419  T
264 tgta 267  Q
    ||||    
12506418 tgta 12506415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 165 - 267
Target Start/End: Complemental strand, 12657711 - 12657608
Alignment:
165 aagattgttgttaaaaatataaaagatatgtttcaaatata-ttttgcgattctagaagattgttgctaaaaatatatccatgaatagtaaatgtatttt 263  Q
    |||||| ||||  |||||||||||||| ||||||||||||| ||||| | ||| || ||||||||||| ||||||||| |||| |||| |||| ||||||    
12657711 aagattattgtagaaaatataaaagatttgtttcaaatatatttttgtgcttcaaggagattgttgctgaaaatatattcatggatagcaaatatatttt 12657612  T
264 tgta 267  Q
    ||||    
12657611 tgta 12657608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 141 - 207
Target Start/End: Original strand, 21989863 - 21989929
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatatt 207  Q
    |||| |||||||||||||||| | || ||||||| |||||||||||||||| |||||||||||||||    
21989863 tgacccaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatatt 21989929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 141 - 206
Target Start/End: Complemental strand, 7349857 - 7349792
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatat 206  Q
    |||||||||| |||||||||| | || ||||||| |||||||||||||||| ||||||||||||||    
7349857 tgactcaaaaattgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatat 7349792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 141 - 206
Target Start/End: Complemental strand, 7352236 - 7352171
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatat 206  Q
    |||||||||| |||||||||| | || ||||||| |||||||||||||||| ||||||||||||||    
7352236 tgactcaaaaattgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatat 7352171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 7470611 - 7470542
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||| ||| ||||||||||||| || ||||||||||||||||||    
7470611 tgactcaaaatttgatggatggagaatattattgctaaaaatataaaacatttgtttcaaatatattttg 7470542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 141 - 206
Target Start/End: Complemental strand, 31156490 - 31156425
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatat 206  Q
    |||||||||| |||||||||| | || ||||||| |||||||||||||||| ||||||||||||||    
31156490 tgactcaaaaattgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatat 31156425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 42331583 - 42331514
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||| ||||||||||| ||||| || ||||||| |||||||||||||||| ||||| ||||||||||||    
42331583 tgacttaaaatttgatgaatgaagaatattgttgctaaaaatataaaagatttgttttaaatatattttg 42331514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 282 - 368
Target Start/End: Complemental strand, 40281828 - 40281741
Alignment:
282 atatttgatgcaaatatatttttaaaa-ggaatatttgaaacaaatatattttgcactgaaggagaaagaaaagacgtatcttcagcg 368  Q
    ||||||||||||||||||| ||||||| |||||||||||  ||||||   ||||  |||||||||||| |||| ||||||||||||||    
40281828 atatttgatgcaaatatatatttaaaagggaatatttgatgcaaatactatttgtgctgaaggagaaaaaaaaaacgtatcttcagcg 40281741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 148 - 210
Target Start/End: Original strand, 38393700 - 38393762
Alignment:
148 aaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    |||||||||||||| | || ||||||| |||||||||| ||||| ||||||||||||||||||    
38393700 aaatttgatggatggagaatattgttgctaaaaatatataagatttgtttcaaatatattttg 38393762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 241
Target Start/End: Original strand, 6628840 - 6628917
Alignment:
165 aagattgttgttaaaaatataaaagatatgtttcaaatata-ttttgcgattctagaagattgttgctaaaaatatat 241  Q
    ||||||| |||  |||||||||||||| ||||||||||||| ||||| | ||| || |||||||||||||||||||||    
6628840 aagattgctgtagaaaatataaaagatttgtttcaaatatatttttgtgcttcaaggagattgttgctaaaaatatat 6628917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 282 - 317
Target Start/End: Original strand, 10690811 - 10690846
Alignment:
282 atatttgatgcaaatatatttttaaaaggaatattt 317  Q
    ||||||||||||||||||||||||||||||||||||    
10690811 atatttgatgcaaatatatttttaaaaggaatattt 10690846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 141 - 191
Target Start/End: Original strand, 20297108 - 20297158
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagat 191  Q
    ||||||||||||||||||||| | || ||||||| ||||||||||||||||    
20297108 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagat 20297158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 282 - 330
Target Start/End: Complemental strand, 40281858 - 40281810
Alignment:
282 atatttgatgcaaatatatttttaaaaggaatatttgaaacaaatatat 330  Q
    ||||||||| |  |||||||||||||||||||||||||  |||||||||    
40281858 atatttgatacggatatatttttaaaaggaatatttgatgcaaatatat 40281810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 85; Significance: 2e-40; HSPs: 22)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 134 - 368
Target Start/End: Complemental strand, 41304971 - 41304748
Alignment:
134 ttgaaattgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttgcgattctagaagattgttgctaa 233  Q
    |||||||||||||||||||||||||||||| ||||||     |||||||||||||||| |||  ||||||||||||| | ||| |||||||||||||| |    
41304971 ttgaaattgactcaaaatttgatggatgaagaagatt-----taaaaatataaaagatttgt--caaatatattttgtgcttccagaagattgttgctga 41304879  T
234 aaatatatccatgaatagtaaatgtatttttgtacccgaatgaagaagatatttgatgcaaatatatttttaaaaggaatatttgaaacaaatatatttt 333  Q
     |||||||  ||| ||||||||| ||||||||||  |  |||||| | | ||||||||||||||||||||| ||||||||||||||  ||||||||||||    
41304878 caatatatttatggatagtaaatatatttttgta--catatgaagga-agatttgatgcaaatatattttt-aaaggaatatttgatgcaaatatatttt 41304783  T
334 gcactgaaggagaaagaaaagacgtatcttcagcg 368  Q
    ||   ||||||| || |||| ||||||||||||||    
41304782 gcgtcgaaggaggaaaaaaaaacgtatcttcagcg 41304748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 134 - 368
Target Start/End: Original strand, 15693576 - 15693808
Alignment:
134 ttgaaattgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttgcgattctagaagattgttgctaa 233  Q
    |||||||||||| ||||||||||||||||| || ||||||| |||||||||||| ||| |||||||||||||||||| | ||| | ||  |||||||| |    
15693576 ttgaaattgacttaaaatttgatggatgaataatattgttgctaaaaatataaa-gatttgtttcaaatatattttgtgcttccaaaaacttgttgctga 15693674  T
234 aaatatatccatgaatagtaaatgtatttttgtacccgaatgaagaagatatttgatgcaaatatatttttaaaaggaatatttgaaacaaatatatttt 333  Q
    ||||||||  |||   | ||||| |||||||||||| | |||||| | | |||||||||||||||||||||||| || ||||||||  ||||||||||||    
15693675 aaatatatttatgggcaataaatatatttttgtacc-gtatgaagga-agatttgatgcaaatatatttttaaaggggatatttgatgcaaatatatttt 15693772  T
334 gcactgaaggagaaagaaa-agacgtatcttcagcg 368  Q
    |  |||||||||||| ||| | ||||||||||||||    
15693773 gtgctgaaggagaaaaaaagaaacgtatcttcagcg 15693808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 134 - 348
Target Start/End: Original strand, 39286881 - 39287089
Alignment:
134 ttgaaattgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttgcgattctagaagattgttgctaa 233  Q
    |||||||||| ||||||||||||||||||    |||||||| |||||||||||| ||| |||||||||||||||||  ||||| |||||||||||||| |    
39286881 ttgaaattgattcaaaatttgatggatga----gattgttgctaaaaatataaatgatttgtttcaaatatattttatgattccagaagattgttgctta 39286976  T
234 aaatatatccatgaatagtaaatgtatttttgtacccgaatgaa-gaagatatttgatgcaaatatatttttaaaaggaatatttgaaacaaatatattt 332  Q
    ||||||||  ||| | | ||||| |||||||||| ||  ||||| ||||  |||||||||||||||||| ||| ||||||||||| |  ||||||||||     
39286977 aaatatatttatggacaataaatatatttttgta-ccatatgaatgaag--atttgatgcaaatatattcttacaaggaatatttaatgcaaatatattg 39287073  T
333 tgcactgaaggagaaa 348  Q
     |  ||||||||||||    
39287074 cgtgctgaaggagaaa 39287089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 135 - 269
Target Start/End: Complemental strand, 41303629 - 41303494
Alignment:
135 tgaaattgactcaaaatttgatggatgaaaaagattgttgttaaaaa-tataaaagatatgtttcaaatatattttgcgattctagaagattgttgctaa 233  Q
    ||||||||||||| ||||||||||||||| |||||||||| |||||| |||||||||| |||||||||||||||||| | ||| | |||||||||||| |    
41303629 tgaaattgactcagaatttgatggatgaagaagattgttgctaaaaaatataaaagatttgtttcaaatatattttgtgcttccataagattgttgctga 41303530  T
234 aaatatatccatgaatagtaaatgtatttttgtacc 269  Q
    ||||||||  ||| | ||||||| || |||||||||    
41303529 aaatatatttatggacagtaaatataattttgtacc 41303494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 134 - 206
Target Start/End: Original strand, 28568339 - 28568411
Alignment:
134 ttgaaattgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatat 206  Q
    |||||||||||||||||||||||||||||| || |||||||||||||||||||||||| ||||||||||||||    
28568339 ttgaaattgactcaaaatttgatggatgaagaatattgttgttaaaaatataaaagatttgtttcaaatatat 28568411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 35216174 - 35216105
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||||| || ||||||| |||||||||||||||| ||||||||||||||||||    
35216174 tgactcaaaatttgatggatgaagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 35216105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 35218555 - 35218486
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||||| || ||||||| |||||||||||||||| ||||||||||||||||||    
35218555 tgactcaaaatttgatggatgaagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 35218486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 134 - 210
Target Start/End: Complemental strand, 28568747 - 28568671
Alignment:
134 ttgaaattgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||||| |||||| || ||||||| ||||| |||||||||| ||||||||||||||||||    
28568747 ttgaaattgactcaaaatttgatagatgaagaatattgttgctaaaactataaaagatttgtttcaaatatattttg 28568671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 27136495 - 27136426
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||||| || |||| || |||||||||||||||| ||||||||||||||||||    
27136495 tgactcaaaatttgatggatgaagaatattggtgctaaaaatataaaagatttgtttcaaatatattttg 27136426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 27583897 - 27583828
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||| ||||||||||||| || ||||||| |||||||||||||||| ||||||||||||||||||    
27583897 tgactcaaattttgatggatgaagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 27583828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 42452459 - 42452528
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||| ||||||||||||||||| || ||||||| |||||||||||||||| ||||||||||||||||||    
42452459 tgacttaaaatttgatggatgaagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 42452528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 42924084 - 42924015
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
42924084 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 42924015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 141 - 209
Target Start/End: Complemental strand, 23452819 - 23452751
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatatttt 209  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| |||||||||||||||||    
23452819 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatatttt 23452751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 34575693 - 34575624
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||||| || ||||||| |||||||||||||||| ||||  ||||||||||||    
34575693 tgactcaaaatttgatggatgaagaatattgttgctaaaaatataaaagatttgttctaaatatattttg 34575624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 368
Target Start/End: Complemental strand, 27583775 - 27583690
Alignment:
282 atatttgatgcaaatatatttttaaaaggaatatttgaaacaaatatattttgcactgaaggagaaagaaaagacgtatcttcagcg 368  Q
    |||||||||||||||||||||| |||||||||||||||  ||||||| | || |||||||||||||| || | | ||||||||||||    
27583775 atatttgatgcaaatatattttgaaaaggaatatttgatgcaaatat-tctttcactgaaggagaaaaaagaaatgtatcttcagcg 27583690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 134 - 191
Target Start/End: Original strand, 7502572 - 7502629
Alignment:
134 ttgaaattgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagat 191  Q
    ||||||||| |||||||||||||||||||| |||||||||| | ||| ||||||||||    
7502572 ttgaaattgtctcaaaatttgatggatgaagaagattgttgctcaaagtataaaagat 7502629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 284 - 368
Target Start/End: Original strand, 7502691 - 7502777
Alignment:
284 atttgatgcaaatatatttttaaaaggaatatttgaaacaaatatattttgcactgaaggag--aaagaaaagacgtatcttcagcg 368  Q
    |||||||||||||||||||||||| | |||||||||  |||||||||||| |  ||||||||  ||| || | ||||||||||||||    
7502691 atttgatgcaaatatatttttaaaggaaatatttgatgcaaatatattttacgttgaaggaggaaaaaaataaacgtatcttcagcg 7502777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 284 - 354
Target Start/End: Complemental strand, 34575588 - 34575519
Alignment:
284 atttgatgcaaatatatttttaaaaggaatatttgaaacaaatatattttgcactgaaggagaaagaaaag 354  Q
    |||||||||||||||||||| ||| |||||||||||  ||||||| | || |||||||||||||| |||||    
34575588 atttgatgcaaatatattttgaaagggaatatttgatgcaaatat-tctttcactgaaggagaaaaaaaag 34575519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 134 - 212
Target Start/End: Original strand, 26345387 - 26345463
Alignment:
134 ttgaaattgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttgcg 212  Q
    ||||||||||||||||| ||  || || ||||||||||||| ||||||||| ||| || ||||| ||||||||||||||    
26345387 ttgaaattgactcaaaagtttctgaat-aaaaagattgttgctaaaaatat-aaatatttgtttaaaatatattttgcg 26345463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 134 - 163
Target Start/End: Complemental strand, 10943010 - 10942981
Alignment:
134 ttgaaattgactcaaaatttgatggatgaa 163  Q
    ||||||||||||||||||||||||||||||    
10943010 ttgaaattgactcaaaatttgatggatgaa 10942981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 134 - 163
Target Start/End: Complemental strand, 10948879 - 10948850
Alignment:
134 ttgaaattgactcaaaatttgatggatgaa 163  Q
    ||||||||||||||||||||||||||||||    
10948879 ttgaaattgactcaaaatttgatggatgaa 10948850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 284 - 368
Target Start/End: Complemental strand, 28568616 - 28568534
Alignment:
284 atttgatgcaaatatatttttaaaaggaatatttgaaacaaatatattttgcactgaaggagaaagaaaagacgtatcttcagcg 368  Q
    |||||||||||||||||||| ||| |||||||||||  || |||| | || ||| |||||||||| |||| | ||||||||||||    
28568616 atttgatgcaaatatattttgaaagggaatatttgatgcatatat-tctttcaccgaaggagaaa-aaaaaaagtatcttcagcg 28568534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 81; Significance: 5e-38; HSPs: 14)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 134 - 342
Target Start/End: Original strand, 30443015 - 30443221
Alignment:
134 ttgaaattgactcaaaattt--gatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttgcgattctagaagattgttgct 231  Q
    ||||||||||||||||||||  |||||||||| || ||||||||||||||||||| |||| |||||||||||||||||  | ||| ||||||||||||||    
30443015 ttgaaattgactcaaaatttatgatggatgaagaatattgttgttaaaaatataagagatttgtttcaaatatattttttgcttccagaagattgttgct 30443114  T
232 aaaaatatatccatgaatagtaaatgtatttttgtacccgaatgaagaagatatttgatgcaaatatatttttaaaaggaatatttgaaacaaatatatt 331  Q
     |||||||||  ||| | |  |||| ||| |||||| ||| || ||| | | ||||||||||||| |||||||||||| ||||||||| |||||||||||    
30443115 gaaaatatatttatggaca--aaatatatgtttgta-ccgtataaagga-agatttgatgcaaatgtatttttaaaagaaatatttgatacaaatatatt 30443210  T
332 ttgcactgaag 342  Q
    |||| ||||||    
30443211 ttgcgctgaag 30443221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 134 - 345
Target Start/End: Original strand, 30445222 - 30445433
Alignment:
134 ttgaaattgactcaaaattt--gatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttgcgattctagaagattgttgct 231  Q
    |||||||||||||||||| |  |||||||||| || ||||||| || |||||||||| || |||||||||||||||||| | ||| |||| |||||||||    
30445222 ttgaaattgactcaaaatctatgatggatgaagaatattgttgctagaaatataaaatatttgtttcaaatatattttgtgcttccagaatattgttgct 30445321  T
232 aaaaatatatccatgaatagtaaatgtatttttgtacccgaatgaagaagatatttgatgcaaatatatttttaaaaggaatatttgaaacaaatatatt 331  Q
     |||||||||  ||||| | ||||| |||||||||| ||  |||||| | | |||||||||||||||||||| |||||||||||||||  |  |||||||    
30445322 gaaaatatatttatgaacaataaatatatttttgta-ccatatgaagga-agatttgatgcaaatatattttaaaaaggaatatttgatgcctatatatt 30445419  T
332 ttgcactgaaggag 345  Q
    |||| |||||||||    
30445420 ttgcgctgaaggag 30445433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 2629469 - 2629400
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||| ||| || ||||||| |||||||||||||||| ||||||||||||||||||    
2629469 tgactcaaaatttgatggaagaagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 2629400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 30035186 - 30035117
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
30035186 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 30035117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 141 - 209
Target Start/End: Original strand, 20526556 - 20526624
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatatttt 209  Q
    |||||||||||||||||| |||| || ||||||| |||||||||||||||| |||||||||||||||||    
20526556 tgactcaaaatttgatgggtgaagaatattgttgctaaaaatataaaagatttgtttcaaatatatttt 20526624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 5275918 - 5275849
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| | ||||||||||||||||    
5275918 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttatttcaaatatattttg 5275849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 18317761 - 18317830
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||| ||| ||| || ||||||| |||||||||||||||| ||||||||||||||||||    
18317761 tgactcaaaatttgaaggaagaagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 18317830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 19705155 - 19705086
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||| ||| || ||||||| |||||||||||||||| ||||||||| ||||||||    
19705155 tgactcaaaatttgatggaagaagaatattgttgctaaaaatataaaagatttgtttcaaagatattttg 19705086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 141 - 206
Target Start/End: Complemental strand, 12196094 - 12196029
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatat 206  Q
    |||||||||| |||||||||| | || ||||||| |||||||||||||||| ||||||||||||||    
12196094 tgactcaaaaattgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatat 12196029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 22858526 - 22858457
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||||| || ||||||  |||||||||||||||| ||||| ||||||| ||||    
22858526 tgactcaaaatttgatggatgaagaatattgttaataaaaatataaaagatttgttttaaatatactttg 22858457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 141 - 206
Target Start/End: Complemental strand, 26933148 - 26933083
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatat 206  Q
    |||||||||| |||||||||| | || ||||||| |||||||||||||||| ||||||||||||||    
26933148 tgactcaaaaattgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatat 26933083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 30966933 - 30967002
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    |||||| |||||||||||||| | || ||||||| |||||||||||||||| | ||||||||||||||||    
30966933 tgactccaaatttgatggatggagaatattgttgctaaaaatataaaagatttatttcaaatatattttg 30967002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 134 - 188
Target Start/End: Original strand, 12158521 - 12158575
Alignment:
134 ttgaaattgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaa 188  Q
    |||||||||| ||||||||||||| ||||| |||||||||| |||||||||||||    
12158521 ttgaaattgagtcaaaatttgatgaatgaagaagattgttgctaaaaatataaaa 12158575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 141 - 189
Target Start/End: Original strand, 17011789 - 17011837
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaag 189  Q
    ||||| ||||||||||||||||| || ||| ||| ||||||||||||||    
17011789 tgacttaaaatttgatggatgaagaatattattgctaaaaatataaaag 17011837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 72; Significance: 1e-32; HSPs: 13)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 134 - 303
Target Start/End: Complemental strand, 13986381 - 13986215
Alignment:
134 ttgaaattgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttgcgattctagaagattgttgctaa 233  Q
    |||||||||||||||||||| ||||||||| |||||||||| ||||||||| |||||| ||||| |||||||||||| | |||||||||||||||| | |    
13986381 ttgaaattgactcaaaattttatggatgaagaagattgttgctaaaaatat-aaagatttgttttaaatatattttgtggttctagaagattgttgttga 13986283  T
234 aaatatatccatgaatagtaaatgtatttttgtacccgaatg-aagaagatatttgatgcaaatatatttt 303  Q
    ||||||||  ||| ||||| |||  ||||||||| ||| ||| ||||||  ||||||||||||||||||||    
13986282 aaatatatttatggatagttaataaatttttgta-ccgcatgaaagaag--atttgatgcaaatatatttt 13986215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 3265742 - 3265673
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
3265742 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 3265673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 3873760 - 3873829
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
3873760 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 3873829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 15808972 - 15809041
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
15808972 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 15809041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 32339104 - 32339173
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
32339104 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 32339173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 43529881 - 43529950
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
43529881 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 43529950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 141 - 209
Target Start/End: Original strand, 41382429 - 41382497
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatatttt 209  Q
    ||||||||||||||||||||| | || |||||||||||||||||||||||| |||||| ||||||||||    
41382429 tgactcaaaatttgatggatggagaatattgttgttaaaaatataaaagatttgtttcgaatatatttt 41382497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 143 - 210
Target Start/End: Original strand, 608482 - 608549
Alignment:
143 actcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||| ||| || ||||||| |||||||||||||||| ||||||||||||||||||    
608482 actcaaaatttgatggaagaagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 608549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 218 - 347
Target Start/End: Complemental strand, 11701457 - 11701333
Alignment:
218 agaagattgttgctaaaaatatatccatgaatagtaaatgtatttttgtacccgaatgaagaagatatttgatgcaaatatatttttaaaaggaatattt 317  Q
    |||||||||||||| |||||||||  |||   ||||||| ||||||||||||  |  ||||||     |||||| ||||||||||||||| |||||||||    
11701457 agaagattgttgctgaaaatatatttatggtcagtaaatatatttttgtaccgtatggaagaa-----ttgatgtaaatatatttttaaagggaatattt 11701363  T
318 gaaacaaatatattttgcactgaaggagaa 347  Q
    ||  |||||||||||||||| |||||||||    
11701362 gatgcaaatatattttgcacggaaggagaa 11701333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 28283803 - 28283734
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||| ||| |||||||||||||||| ||||||||||||||||||    
28283803 tgactcaaaatttgatggatggagaatatttttgctaaaaatataaaagatttgtttcaaatatattttg 28283734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 141 - 209
Target Start/End: Original strand, 41384503 - 41384571
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatatttt 209  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| |||||| ||||||||||    
41384503 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcgaatatatttt 41384571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 134 - 210
Target Start/End: Complemental strand, 30679263 - 30679188
Alignment:
134 ttgaaattgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    |||||||||||||||||||||||||||||| || | ||||| |||||||| ||||||| ||||| | ||||||||||    
30679263 ttgaaattgactcaaaatttgatggatgaagaata-tgttggtaaaaataaaaaagatttgttttagatatattttg 30679188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 135 - 185
Target Start/End: Complemental strand, 11701485 - 11701435
Alignment:
135 tgaaattgactcaaaatttgatggatgaaaaagattgttgttaaaaatata 185  Q
    ||||||||||||||||||||||||| ||| |||||||||| | ||||||||    
11701485 tgaaattgactcaaaatttgatggacgaagaagattgttgctgaaaatata 11701435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 72; Significance: 1e-32; HSPs: 24)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 137 - 240
Target Start/End: Complemental strand, 38209263 - 38209160
Alignment:
137 aaattgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttgcgattctagaagattgttgctaaaaa 236  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |||||||||||| | ||| |||||||||||| | ||||    
38209263 aaattgactcaaaatttgatggatgaaaaatattgttgttaaaaatataaaagatttgttttaaatatattttgtgcttcaagaagattgttgttgaaaa 38209164  T
237 tata 240  Q
    ||||    
38209163 tata 38209160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 134 - 269
Target Start/End: Complemental strand, 29609994 - 29609859
Alignment:
134 ttgaaattgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttgcgattctagaagattgttgctaa 233  Q
    |||||||| | ||||||||||||||||||| || ||||||| ||||| |||    ||| | |||||||||||||||| | |||||||||||||||| | |    
29609994 ttgaaattaattcaaaatttgatggatgaagaatattgttgctaaaagtattcttgatttttttcaaatatattttgtgcttctagaagattgttgatga 29609895  T
234 aaatatatccatgaatagtaaatgtatttttgtacc 269  Q
    ||||||||  ||||| ||||||| ||||||||||||    
29609894 aaatatatttatgaagagtaaatatatttttgtacc 29609859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 134 - 333
Target Start/End: Complemental strand, 54929274 - 54929077
Alignment:
134 ttgaaattgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttgcga--ttctagaagattgttgct 231  Q
    |||||||||||| |||||||||||||  || || ||||||| |||||||||||||||| || || |||| ||||||| |   ||   ||||||| |||||    
54929274 ttgaaattgacttaaaatttgatgga--aataatattgttgctaaaaatataaaagatttgatttaaatgtattttgtgtgctttcggaagattattgct 54929177  T
232 aaaaatatatccatgaatagtaaatgtatttttgtacccgaatgaagaagatatttgatgcaaatatatttttaaaaggaatatttgaaacaaatatatt 331  Q
     |||||||||  ||| | |  |||| |||||||||||| | |||||| | | ||||||||||||||||||||||| ||||||||||||  ||||||||||    
54929176 gaaaatatatttatggacaaaaaatatatttttgtacc-gtatgaagga-agatttgatgcaaatatatttttaataggaatatttgatgcaaatatatt 54929079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 22135209 - 22135140
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
22135209 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 22135140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 24347969 - 24348038
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
24347969 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 24348038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 56030199 - 56030268
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
56030199 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 56030268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 141 - 208
Target Start/End: Complemental strand, 38890691 - 38890624
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattt 208  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||    
38890691 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattt 38890624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 165 - 335
Target Start/End: Original strand, 10979613 - 10979780
Alignment:
165 aagattgttgttaaaaatataaaagatatgtttcaaatatattttgcgattctagaagattgttgctaaaaatatatccatgaatagtaaatgtattttt 264  Q
    |||||||||  | |||||||||||||| |  ||||||||||||||| | ||| |||||||||||||| |||||||||  ||| | |  |||| |||||||    
10979613 aagattgttaatgaaaatataaaagatttacttcaaatatattttgtgcttcaagaagattgttgctgaaaatatatttatggacaacaaatatattttt 10979712  T
265 gtacccgaatgaagaagatatttgatgcaaatatatttttaaaaggaatatttgaaacaaatatattttgc 335  Q
    ||  | | |||||| | | ||||||||||||||||||||| ||||||||||||||  ||||||||| ||||    
10979713 gt-gctgtatgaagga-agatttgatgcaaatatattttt-aaaggaatatttgatgcaaatatatcttgc 10979780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 5100753 - 5100822
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||| ||||||||||||    
5100753 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgttttaaatatattttg 5100822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 14788011 - 14787942
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || | ||||| |||||||||||||||| ||||||||||||||||||    
14788011 tgactcaaaatttgatggatggagaataatgttgctaaaaatataaaagatttgtttcaaatatattttg 14787942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 145 - 210
Target Start/End: Complemental strand, 22132973 - 22132908
Alignment:
145 tcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
22132973 tcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 22132908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 47211298 - 47211229
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||| ||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
47211298 tgacttaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 47211229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 134 - 333
Target Start/End: Complemental strand, 5516846 - 5516653
Alignment:
134 ttgaaattgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttgcgattctagaagattgttgctaa 233  Q
    |||||||||| | ||||||||||| ||| | || ||||||| |||||||||||| ||  |||||||||||||||||  | || | |||||| ||||||||    
5516846 ttgaaattgatttaaaatttgatgaatggagaatattgttgctaaaaatataaatgaattgtttcaaatatattttatgtttttggaagatcgttgctaa 5516747  T
234 aaatatatccatgaatagtaaatgtatttttgtacccgaatgaagaagatatttgatgcaaatatatttttaaaa-ggaatatttgaaacaaatatattt 332  Q
    ||||||||  ||  ||| ||||| ||||||| ||  || |||||| | ||     |||||||||||||||||||| |||||||||||  |||||||||||    
5516746 aaatatatttatagataataaatatattttttta-tcgtatgaagga-at-----atgcaaatatatttttaaaagggaatatttgatgcaaatatattt 5516654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 141 - 202
Target Start/End: Complemental strand, 14789561 - 14789500
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaat 202  Q
    ||||||||||||||||||||||| || | ||||| |||||||||||||||| ||||||||||    
14789561 tgactcaaaatttgatggatgaagaataatgttgctaaaaatataaaagatttgtttcaaat 14789500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 141 - 206
Target Start/End: Complemental strand, 44600418 - 44600353
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatat 206  Q
    |||||||||| |||||||||| | || ||||||| |||||||||||||||| ||||||||||||||    
44600418 tgactcaaaaattgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatat 44600353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 145 - 209
Target Start/End: Original strand, 9022074 - 9022138
Alignment:
145 tcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatatttt 209  Q
    ||||||||| |||||||| ||| ||||||||| |||||||||| ||| |||||||||||||||||    
9022074 tcaaaattttatggatgagaaatattgttgttgaaaatataaatgatttgtttcaaatatatttt 9022138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 148 - 210
Target Start/End: Complemental strand, 17662809 - 17662747
Alignment:
148 aaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    |||||||||||||| | || ||||||| |||||||||||||||| ||||| ||||||||||||    
17662809 aaatttgatggatggagaatattgttgctaaaaatataaaagatttgttttaaatatattttg 17662747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 9863509 - 9863578
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    |||||||||||||| ||||||||| | ||||||  |||||||||||| ||| ||||||||| ||||||||    
9863509 tgactcaaaatttgttggatgaaatatattgttactaaaaatataaatgatttgtttcaaacatattttg 9863578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 147 - 206
Target Start/End: Original strand, 30136331 - 30136390
Alignment:
147 aaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatat 206  Q
    ||||||||||| ||| | || ||||||| |||||||||||||||| ||||||||||||||    
30136331 aaaatttgatgaatggagaatattgttgctaaaaatataaaagatttgtttcaaatatat 30136390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 32274398 - 32274322
Alignment:
163 aaaagattgttgttaaaaatataaaagatatgtttcaaatatattttgcgattctagaagattgttgctaaaaatatat 241  Q
    |||||||||||  ||||||||||||| |||||||  |||||||||||| | |||||||| ||||||||| |||||||||    
32274398 aaaagattgttactaaaaatataaaa-atatgttg-aaatatattttgtgcttctagaaaattgttgctgaaaatatat 32274322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 141 - 209
Target Start/End: Original strand, 19322418 - 19322487
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgtt-gttaaaaatataaaagatatgtttcaaatatatttt 209  Q
    ||||||||||||||||||||| | || ||| || | |||||||||||||||| ||||| |||||||||||    
19322418 tgactcaaaatttgatggatggagaatattttttgctaaaaatataaaagatttgttttaaatatatttt 19322487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 284 - 334
Target Start/End: Complemental strand, 38209131 - 38209080
Alignment:
284 atttgatgcaaatatattttt-aaaaggaatatttgaaacaaatatattttg 334  Q
    ||||||||||||||||| ||| |||||||||||||||  |||||||||||||    
38209131 atttgatgcaaatatatatttgaaaaggaatatttgatgcaaatatattttg 38209080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 284 - 328
Target Start/End: Original strand, 9022193 - 9022237
Alignment:
284 atttgatgcaaatatatttttaaaaggaatatttgaaacaaatat 328  Q
    |||||||||||||||||||| ||| |||||||||||  |||||||    
9022193 atttgatgcaaatatattttaaaagggaatatttgatgcaaatat 9022237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 10112636 - 10112701
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||| |||||||| || ||||| || ||||||| ||||||||||||||    |||||||||||||||||    
10112636 tgacttaaaatttgttgaatgaagaatattgttgctaaaaatataaaag----gtttcaaatatattttg 10112701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 66; Significance: 4e-29; HSPs: 21)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 134 - 231
Target Start/End: Complemental strand, 53974204 - 53974107
Alignment:
134 ttgaaattgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttgcgattctagaagattgttgct 231  Q
    |||||||||||||||||||||||||||||| ||  ||||||||||||||||||||||| |||||||| ||||||||| | ||| ||||||||||||||    
53974204 ttgaaattgactcaaaatttgatggatgaagaatgttgttgttaaaaatataaaagatttgtttcaattatattttgtgcttccagaagattgttgct 53974107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 134 - 238
Target Start/End: Original strand, 11072637 - 11072741
Alignment:
134 ttgaaattgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttgcgattctagaagattgttgctaa 233  Q
    |||||||||||||||||||||||||||||| ||||||||||  ||||||||||| ||| |||||||||||||| ||| | ||| |||||||||||||| |    
11072637 ttgaaattgactcaaaatttgatggatgaagaagattgttgcaaaaaatataaatgatttgtttcaaatatatcttgtgcttccagaagattgttgctga 11072736  T
234 aaata 238  Q
    |||||    
11072737 aaata 11072741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 135 - 342
Target Start/End: Original strand, 11066249 - 11066455
Alignment:
135 tgaaattgactcaaaatttgatggatgaaaaagattgttg-ttaaaaatataaaagatatgtttcaaatatattttgcgattctagaagattgttgctaa 233  Q
    ||||||||||||| ||||||||||||||| || ||||||| | ||||| ||||| ||| |||||||||||||| ||| | ||   ||||||||||| | |    
11066249 tgaaattgactcataatttgatggatgaagaatattgttgctaaaaaagataaatgatttgtttcaaatatatcttgtgctttcggaagattgttgttga 11066348  T
234 aaatatatccatgaatagtaaatgtatttttgtacccgaatgaagaagatatttgatgcaaatatatttttaaaaggaatatttgaaacaaatatatttt 333  Q
    ||||| ||  ||| | | ||||| ||||||| || ||  |||||| | ||||||||||||||||||||||||||  ||||||||||  |||||||||| |    
11066349 aaatacatttatggacaataaatatattttttta-ccatatgaagga-atatttgatgcaaatatatttttaaagagaatatttgatgcaaatatattat 11066446  T
334 gcactgaag 342  Q
    || ||||||    
11066447 gcgctgaag 11066455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 51943052 - 51943121
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||||| || ||||||| |||||||||||||||| ||||||||||||||||||    
51943052 tgactcaaaatttgatggatgaagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 51943121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 746432 - 746501
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
746432 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 746501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 41848814 - 41848883
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
41848814 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 41848883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 42991963 - 42992032
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || |||||||||||||||||||||| | ||||||||||||||||||    
42991963 tgactcaaaatttgatggatggagaatattgttgttaaaaatataaaaggtttgtttcaaatatattttg 42992032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 53918240 - 53918171
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
53918240 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 53918171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 141 - 209
Target Start/End: Original strand, 25533117 - 25533185
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatatttt 209  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| |||||||||||||||||    
25533117 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatatttt 25533185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 165 - 303
Target Start/End: Complemental strand, 54287625 - 54287489
Alignment:
165 aagattgttgttaaaaatataaaagatatgtttcaaatatattttgcgattctagaagattgttgctaaaaatatatccatgaatagtaaatgtattttt 264  Q
    |||||||||| |||||||||||||||| |||||||||||||||| | | ||| | ||||||| || | |||||||||  ||| ||| |||||  ||||||    
54287625 aagattgttgctaaaaatataaaagatttgtttcaaatatatttcgtgcttccaaaagattgctgttgaaaatatatttatggataataaatacattttt 54287526  T
265 gtacccgaatgaagaagatatttgatgcaaatatatttt 303  Q
    ||| | | |||||| | ||||||||||||||||||||||    
54287525 gta-ctgtatgaagga-atatttgatgcaaatatatttt 54287489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 455583 - 455652
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    |||||||||||||||||||||   || ||||||| |||||||||||||||| ||||||||||||||||||    
455583 tgactcaaaatttgatggatggggaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 455652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 457960 - 458029
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    |||||||||||||||||||||   || ||||||| |||||||||||||||| ||||||||||||||||||    
457960 tgactcaaaatttgatggatggggaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 458029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 1313092 - 1313161
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||| ||| ||||||||||||||||||    
1313092 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaatgatttgtttcaaatatattttg 1313161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 206
Target Start/End: Complemental strand, 10622117 - 10622052
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatat 206  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||    
10622117 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatat 10622052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 53916072 - 53916003
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||| ||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
53916072 tgactcaaaatttgagggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 53916003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 141 - 205
Target Start/End: Complemental strand, 4104473 - 4104409
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatata 205  Q
    ||||||||||||||||||| ||| || ||||||| |||||||||||||||| |||||||||||||    
4104473 tgactcaaaatttgatggaagaagaatattgttgctaaaaatataaaagatttgtttcaaatata 4104409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 141 - 205
Target Start/End: Original strand, 6561623 - 6561687
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatata 205  Q
    |||||| |||||||||||||||| || ||||||| |||||||||||||||| |||||||||||||    
6561623 tgactcgaaatttgatggatgaagaatattgttgctaaaaatataaaagatttgtttcaaatata 6561687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 141 - 209
Target Start/End: Original strand, 42989962 - 42990030
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatatttt 209  Q
    ||||||||||||||||||||| | || ||||||| ||||||||||||| || |||||||||||||||||    
42989962 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaaaatttgtttcaaatatatttt 42990030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 147 - 210
Target Start/End: Complemental strand, 27636196 - 27636133
Alignment:
147 aaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||| | || ||||||| ||||||||||||| ||  |||||||||||||||||    
27636196 aaaatttgatggatggagaatattgttgctaaaaatataaaatattagtttcaaatatattttg 27636133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 177 - 241
Target Start/End: Original strand, 12019168 - 12019233
Alignment:
177 aaaaatataaaagatatgtttcaaatat-attttgcgattctagaagattgttgctaaaaatatat 241  Q
    ||||||| ||||||| |||||||||||| |||||||| ||| || ||||||||||||||| |||||    
12019168 aaaaatagaaaagatttgtttcaaatataattttgcgtttcaaggagattgttgctaaaattatat 12019233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 284 - 316
Target Start/End: Original strand, 41848938 - 41848970
Alignment:
284 atttgatgcaaatatatttttaaaaggaatatt 316  Q
    |||||||||||||||||||| ||||||||||||    
41848938 atttgatgcaaatatattttgaaaaggaatatt 41848970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 53; Significance: 2e-21; HSPs: 23)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 134 - 210
Target Start/End: Complemental strand, 5779224 - 5779148
Alignment:
134 ttgaaattgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    |||||||||||| |||||||||| |||||| |||||| ||| |||||||||||||||| ||||||||||||||||||    
5779224 ttgaaattgacttaaaatttgatagatgaagaagattattgctaaaaatataaaagatttgtttcaaatatattttg 5779148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 141 - 209
Target Start/End: Complemental strand, 17415890 - 17415822
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatatttt 209  Q
    ||||||||||||||||||||||| || ||||||| |||||||||||||||| |||||||||||||||||    
17415890 tgactcaaaatttgatggatgaagaatattgttgctaaaaatataaaagatttgtttcaaatatatttt 17415822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 18511792 - 18511723
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||||| || ||||||| |||||||||||||||| |||||| |||||||||||    
18511792 tgactcaaaatttgatggatgaagaatattgttgctaaaaatataaaagatttgtttcgaatatattttg 18511723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 18596336 - 18596405
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
18596336 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 18596405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 25803717 - 25803786
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
25803717 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 25803786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 27912229 - 27912298
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
27912229 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 27912298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 206
Target Start/End: Original strand, 15551935 - 15552000
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatat 206  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||    
15551935 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatat 15552000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 18468708 - 18468777
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||| ||| |||||||||||||||| ||||||||||||||||||    
18468708 tgactcaaaatttgatggatggagaatatttttgctaaaaatataaaagatttgtttcaaatatattttg 18468777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 26097431 - 26097500
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| ||||||||||||| || ||||||||||||||||||    
26097431 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaaaatttgtttcaaatatattttg 26097500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 26098831 - 26098762
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||| ||| |||||||||||||||| ||||||||||||||||||    
26098831 tgactcaaaatttgatggatggagaatattattgctaaaaatataaaagatttgtttcaaatatattttg 26098762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 27910145 - 27910214
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||| ||| |||||||||||||||| ||||||||||||||||||    
27910145 tgactcaaaatttgatggatggagaatattattgctaaaaatataaaagatttgtttcaaatatattttg 27910214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 40221292 - 40221361
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||| || |||||| || ||||||| |||||||||||||||| ||||||||||||||||||    
40221292 tgactcaaaatttaattgatgaagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 40221361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 141 - 206
Target Start/End: Complemental strand, 3373620 - 3373555
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatat 206  Q
    ||||||| ||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||    
3373620 tgactcagaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatat 3373555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 6662023 - 6661954
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||| |||| |||||||||||| || ||||||| ||||||||||||| || ||||||||||||||||||    
6662023 tgacttaaaacttgatggatgaagaatattgttgctaaaaatataaaatatttgtttcaaatatattttg 6661954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 18509897 - 18509828
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| | |||| |||||||||||    
18509897 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttatttcgaatatattttg 18509828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 143 - 210
Target Start/End: Original strand, 21288541 - 21288608
Alignment:
143 actcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||| | || ||||||| |||||||| ||||||| ||||| ||||||||||||    
21288541 actcaaaatttgatggatggagaatattgttgctaaaaataaaaaagatttgtttaaaatatattttg 21288608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 284 - 353
Target Start/End: Complemental strand, 5779112 - 5779040
Alignment:
284 atttgatgcaaatatattttta---aaaggaatatttgaaacaaatatattttgcactgaaggagaaagaaaa 353  Q
    |||||||||||||||||||||    |||| |||||||||  |||||||||||||||||||||||| |||||||    
5779112 atttgatgcaaatatattttttttgaaagaaatatttgatgcaaatatattttgcactgaaggaggaagaaaa 5779040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 218 - 368
Target Start/End: Original strand, 32520231 - 32520381
Alignment:
218 agaagattgttgctaaaaatatatccatgaatagtaaa--tgtatttttgtacccgaatgaagaagatatttgatgcaaatatatttttaaaaggaatat 315  Q
    |||||||||||||| |||||||||  ||| | ||||||  | |||||||||||| | | |||||| | |||||||||||| ||||||||||||  |||||    
32520231 agaagattgttgctgaaaatatatttatgtagagtaaaaatatatttttgtacc-gtacgaagaaaa-atttgatgcaaacatatttttaaaataaatat 32520328  T
316 ttgaaacaaatatattttgcactgaaggagaaagaaaagacgtatcttcagcg 368  Q
    || |  |||||||||||||| || ||||||| | || | || |||||||||||    
32520329 ttaatgcaaatatattttgcgcttaaggagagaaaacaaacatatcttcagcg 32520381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 151 - 210
Target Start/End: Original strand, 10586549 - 10586608
Alignment:
151 tttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    |||||||||||   || ||||||| |||||||||||||||| ||||||||||||||||||    
10586549 tttgatggatggggaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 10586608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 134 - 185
Target Start/End: Original strand, 32520202 - 32520253
Alignment:
134 ttgaaattgactcaaaatttgatggatgaaaaagattgttgttaaaaatata 185  Q
    ||||||| |||| ||||||||||||||||| |||||||||| | ||||||||    
32520202 ttgaaatagacttaaaatttgatggatgaagaagattgttgctgaaaatata 32520253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 218 - 328
Target Start/End: Original strand, 15143252 - 15143360
Alignment:
218 agaagattgttgctaaaaatatatccatgaatagtaaatgtatttttgtacccgaatgaagaagatatttgatgcaaatatatttttaaaaggaatattt 317  Q
    |||| |||||||||||||||||||  ||| | | |||||  |||||||||||  | ||||| | | |||||||||||||||||||| ||| |||||||||    
15143252 agaatattgttgctaaaaatatatttatggacaataaatacatttttgtaccata-tgaagga-agatttgatgcaaatatattttgaaagggaatattt 15143349  T
318 gaaacaaatat 328  Q
    ||  |||||||    
15143350 gatgcaaatat 15143360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 141 - 185
Target Start/End: Original strand, 15143230 - 15143274
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatata 185  Q
    ||||||||||||||||||||| | || ||||||| ||||||||||    
15143230 tgactcaaaatttgatggatggagaatattgttgctaaaaatata 15143274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 141 - 185
Target Start/End: Original strand, 18466421 - 18466465
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatata 185  Q
    ||||||||||||||||||||| | || ||||||| ||||||||||    
18466421 tgactcaaaatttgatggatggagaatattgttgctaaaaatata 18466465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1674 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: scaffold1674
Description:

Target: scaffold1674; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 85 - 16
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
85 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 16  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0468 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: scaffold0468
Description:

Target: scaffold0468; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 210
Target Start/End: Complemental strand, 2175 - 2106
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||||||||||||||    
2175 tgactcaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 2106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0008 (Bit Score: 49; Significance: 6e-19; HSPs: 1)
Name: scaffold0008
Description:

Target: scaffold0008; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 134 - 305
Target Start/End: Complemental strand, 58002 - 57834
Alignment:
134 ttgaaattgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattt--tgcgattctagaagattgttgct 231  Q
    |||||||||||||||||||||||||||||  |  ||||||  ||||| |||||||||| ||||| | |||| |||  || | ||| |||||||||||| |    
58002 ttgaaattgactcaaaatttgatggatgatga--attgtttctaaaagtataaaagatttgttttatatattttttgtgtgcttccagaagattgttgtt 57905  T
232 aaaaatatatccatgaatagtaaatgtatttttgtacccgaatgaagaagatatttgatgcaaatatattttta 305  Q
     |||||||||  ||||| | ||||| |||||||||| ||| |||||||  | ||||||||||||||||||||||    
57904 gaaaatatatgtatgaacaataaatatatttttgta-ccgtatgaaga--aaatttgatgcaaatatattttta 57834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0511 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: scaffold0511
Description:

Target: scaffold0511; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 1745 - 1814
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||| ||| ||| || ||||||| |||||||||||||||| ||||||||||||||||||    
1745 tgactcaaaatttgaaggaagaagaatattgttgctaaaaatataaaagatttgtttcaaatatattttg 1814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0133 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: scaffold0133
Description:

Target: scaffold0133; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 143 - 208
Target Start/End: Original strand, 4558 - 4623
Alignment:
143 actcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattt 208  Q
    ||||||||||||||||||||| || ||||||| |||||||||||||||| |||||| |||||||||    
4558 actcaaaatttgatggatgaagaatattgttgctaaaaatataaaagatttgtttcgaatatattt 4623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 46; Significance: 4e-17; HSPs: 2)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 51719 - 51788
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||||||| | || | ||||| |||||||||||||||| ||||||||||||||||||    
51719 tgactcaaaatttgatggatggagaataatgttgctaaaaatataaaagatttgtttcaaatatattttg 51788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 141 - 202
Target Start/End: Original strand, 50169 - 50230
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaat 202  Q
    ||||||||||||||||||||||| || | ||||| |||||||||||||||| ||||||||||    
50169 tgactcaaaatttgatggatgaagaataatgttgctaaaaatataaaagatttgtttcaaat 50230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0154 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 1)
Name: scaffold0154
Description:

Target: scaffold0154; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 145 - 210
Target Start/End: Complemental strand, 12047 - 11982
Alignment:
145 tcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatattttg 210  Q
    ||||||||||||||||| | || ||||||| ||||||||||||| || ||||||||||||||||||    
12047 tcaaaatttgatggatggagaatattgttgctaaaaatataaaaaatttgtttcaaatatattttg 11982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0031 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0031
Description:

Target: scaffold0031; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 141 - 209
Target Start/End: Original strand, 78893 - 78961
Alignment:
141 tgactcaaaatttgatggatgaaaaagattgttgttaaaaatataaaagatatgtttcaaatatatttt 209  Q
    ||||| ||||||||||||||| | || ||||||| |||||||||||||||| ||| |||||||||||||    
78893 tgacttaaaatttgatggatggagaatattgttgctaaaaatataaaagatttgtctcaaatatatttt 78961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0533 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0533
Description:

Target: scaffold0533; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 178 - 241
Target Start/End: Complemental strand, 2263 - 2199
Alignment:
178 aaaatataaaagatatgtttcaaatatattttgc-gattctagaagattgttgctaaaaatatat 241  Q
    |||||||||||||| |||||||||||||||||   | ||| || ||||||||||| |||||||||    
2263 aaaatataaaagatttgtttcaaatatatttttatgtttcaagtagattgttgctgaaaatatat 2199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 106156 times since January 2019
Visitors: 1319