View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk81-10 (Length: 283)

Name: R108-tnk81-10
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk81-10
R108-tnk81-10
[»] chr3 (23 HSPs)
chr3 (8-283)||(10582477-10582750)
chr3 (12-282)||(10197541-10197811)
chr3 (1-282)||(10262566-10262847)
chr3 (12-282)||(10090658-10090929)
chr3 (1-283)||(10361724-10362003)
chr3 (1-283)||(10431964-10432246)
chr3 (9-282)||(10665394-10665658)
chr3 (8-283)||(10519352-10519624)
chr3 (18-283)||(11779922-11780184)
chr3 (7-283)||(10373774-10374047)
chr3 (18-283)||(11771101-11771363)
chr3 (8-283)||(9851606-9851878)
chr3 (8-283)||(10128792-10129064)
chr3 (8-281)||(10079279-10079549)
chr3 (8-281)||(10186249-10186519)
chr3 (8-283)||(9840728-9840997)
chr3 (7-283)||(10033867-10034140)
chr3 (8-283)||(10502450-10502722)
chr3 (199-283)||(10679305-10679389)
chr3 (66-283)||(10530514-10530731)
chr3 (69-138)||(11129020-11129089)
chr3 (100-152)||(13162975-13163027)
chr3 (100-152)||(13334899-13334951)
[»] chr2 (1 HSPs)
chr2 (8-279)||(26908759-26909027)
[»] scaffold0083 (1 HSPs)
scaffold0083 (8-283)||(55532-55804)
[»] chr8 (2 HSPs)
chr8 (18-283)||(11486902-11487164)
chr8 (66-283)||(44955662-44955879)
[»] chr4 (1 HSPs)
chr4 (179-283)||(17851024-17851128)
[»] chr1 (1 HSPs)
chr1 (98-145)||(827895-827942)
[»] scaffold0002 (2 HSPs)
scaffold0002 (100-152)||(143961-144013)
scaffold0002 (100-152)||(152266-152318)


Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 23)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 8 - 283
Target Start/End: Complemental strand, 10582750 - 10582477
Alignment:
8 caagcccatcgatattaattttcttt-actgncgacaaccaatgcaaagtgtttggctctgtttccaatagatgagaacacccttttattacaatttctt 106  Q
    |||||||||| || |||||||| ||| | || |||||||||||||||||||   |||||||||||||||||||||  ||| |||| |||| |||||||||    
10582750 caagcccatcaatcttaatttttttttattgacgacaaccaatgcaaagtg---ggctctgtttccaatagatgaacacaaccttctatttcaatttctt 10582654  T
107 ctatgcaaggaagatggctaggcaaatgtccctttagtttgggacaattacgtaacttcatagctcgaagttgaggaaaagcaaattttatgccttcaaa 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
10582653 ctatgcaaggaagatggctaggcaaatgtccctttagtttgggacaattacgtaacttcatagctcgaagttgaggaaaagcaaattgtatgccttcaaa 10582554  T
207 gggaagccattgattccaatttggtatattgtcgaattttatatactcaagggatggaaatggttggaaggaagaat 283  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10582553 gggaagccatttattccaatttggtatattgtcgaattttatatactcaagggatggaaatggttggaaggaagaat 10582477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 12 - 282
Target Start/End: Complemental strand, 10197811 - 10197541
Alignment:
12 cccatcgatattaattttctttactgncgacaaccaatgcaaagtgtttggctctgtttccaatagatgagaacacccttttattacaatttcttctatg 111  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||    
10197811 cccatcgatattaattttctttactgacgacaaccaatgcaaagtgtttggctctgtttccaatagatgagaacaaccttttattacaatttcttttatg 10197712  T
112 caaggaagatggctaggcaaatgtccctttagtttgggacaattacgtaacttcatagctcgaagttgaggaaaagcaaattttatgccttcaaagggaa 211  Q
    |||||||| | |||||||||||||||| ||||||   ||||||||||||||| |||||||| |||| |||||||||||||||||||||||||| ||||||    
10197711 caaggaaggttgctaggcaaatgtccccttagttctcgacaattacgtaactccatagctctaagtcgaggaaaagcaaattttatgccttcatagggaa 10197612  T
212 gccattgattccaatttggtatattgtcgaattttatatactcaagggatggaaatggttggaaggaagaa 282  Q
    |||||| |||||||||||| || |||||||||||||||  |||||||| ||||||||| ||||||||||||    
10197611 gccattcattccaatttggcatgttgtcgaattttatacgctcaagggttggaaatggctggaaggaagaa 10197541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 282
Target Start/End: Complemental strand, 10262847 - 10262566
Alignment:
1 cttccatcaagcccatcgatattaattttctttactgncgacaaccaatgcaaagtgtttggctctgtttccaatagatgagaacacccttttattacaa 100  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
10262847 cttccatcaagcccatcgatattaattttctttactgacgacaaccaatgcaaagtgtttggctctgtttccaatagatgagaacaaccttttattacaa 10262748  T
101 tttcttctatgcaaggaagatggctaggcaaatgtccctttagtttgggacaattacgtaacttcatagctcgaagttgaggaaaagcaaattttatgcc 200  Q
    ||||||||||||||||||| | ||||||||||||| || ||||||  ||||||||| |||||| |||||||| |||| ||||||||| || |||||||||    
10262747 tttcttctatgcaaggaagtttgctaggcaaatgttcccttagttctggacaattatgtaactccatagctctaagtcgaggaaaagaaagttttatgcc 10262648  T
201 ttcaaagggaagccattgattccaatttggtatattgtcgaattttatatactcaagggatggaaatggttggaaggaagaa 282  Q
    |||| |||||||||||| |||||||||||| |   ||| ||||||||||  |||||||||| ||||||||||||||||||||    
10262647 ttcatagggaagccattcattccaatttggcaagctgttgaattttatacgctcaagggattgaaatggttggaaggaagaa 10262566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 12 - 282
Target Start/End: Complemental strand, 10090929 - 10090658
Alignment:
12 cccatcgatattaattttctttactgncgacaaccaatgcaaagtgtttggctctgtttccaatagatgagaacacccttttattacaatttcttctatg 111  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||    
10090929 cccatcgatattaattttctttactgacgacaaccaatgcaaagtgtttggctctgtttccaatagatgagaacaaccttttattacaatttcttttatg 10090830  T
112 caaggaagatggctaggcaaatgtccctttagtttgggacaattacgt-aacttcatagctcgaagttgaggaaaagcaaattttatgccttcaaaggga 210  Q
    |||||||| | |||||||||||||||| ||||||   |||||||||||  ||| |||||||| |||| |||||||||||||||||||||||||| |||||    
10090829 caaggaaggttgctaggcaaatgtccccttagttctcgacaattacgtgtactccatagctctaagtcgaggaaaagcaaattttatgccttcataggga 10090730  T
211 agccattgattccaatttggtatattgtcgaattttatatactcaagggatggaaatggttggaaggaagaa 282  Q
    ||||||| |||||||||||| || |||||||||||||||  |||||||| ||||||||| ||||||||||||    
10090729 agccattcattccaatttggcatgttgtcgaattttatacgctcaagggttggaaatggctggaaggaagaa 10090658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 1 - 283
Target Start/End: Original strand, 10361724 - 10362003
Alignment:
1 cttccatcaagcccatcgatattaattttctttactgncgacaaccaatgcaaagtgtttggctctgtttccaatagatgagaacacccttttattacaa 100  Q
    ||||||||||||||||| || ||||  || |||| || |||||||||||||||||||   |||||||||||||||||||||||||| |||| ||||||||    
10361724 cttccatcaagcccatcaatcttaaaattttttattgacgacaaccaatgcaaagtg---ggctctgtttccaatagatgagaacaaccttgtattacaa 10361820  T
101 tttcttctatgcaaggaagatggctaggcaaatgtccctttagtttgggacaattacgtaacttcatagctcgaagttgaggaaaagcaaattttatgcc 200  Q
    ||||||||||||||||||| | ||| |||||||||||| ||||||  ||||||||| |||||| |||||||| |||||||||||||||| ||||||||||    
10361821 tttcttctatgcaaggaaggttgctcggcaaatgtccccttagttctggacaattatgtaactccatagctctaagttgaggaaaagcacattttatgcc 10361920  T
201 ttcaaagggaagccattgattccaatttggtatattgtcgaattttatatactcaagggatggaaatggttggaaggaagaat 283  Q
    ||||||||||| ||||| |||||||||||| || |||||||| |||||   ||||||||||||||||||||||||||||||||    
10361921 ttcaaagggaatccattcattccaatttggcatgttgtcgaaatttatgcgctcaagggatggaaatggttggaaggaagaat 10362003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 1 - 283
Target Start/End: Original strand, 10431964 - 10432246
Alignment:
1 cttccatcaagcccatcgatattaattttctttactgncgacaaccaatgcaaagtgtttggctctgtttccaatagatgagaacacccttttattacaa 100  Q
    ||||| |||||||||| |||||||| |||||||| || |||||||||||||| |||||||||||||||||||| ||| |||||||| |||  |||  |||    
10431964 cttccgtcaagcccattgatattaactttctttattgacgacaaccaatgcatagtgtttggctctgtttccagtagttgagaacaacctgatatatcaa 10432063  T
101 tttcttctatgcaaggaagatggctaggcaaatgtccctttagtttgggacaattacgtaacttcatagctcgaagttgaggaaaagcaaattttatgcc 200  Q
    ||||||||||||||||||| | ||||||||| |||||| ||||||  ||||||||| |||||| |||| ||| |||| |||||||||||| |||||||||    
10432064 tttcttctatgcaaggaaggttgctaggcaattgtccccttagttcaggacaattatgtaactccataactctaagtcgaggaaaagcaacttttatgcc 10432163  T
201 ttcaaagggaagccattgattccaatttggtatattgtcgaattttatatactcaagggatggaaatggttggaaggaagaat 283  Q
    ||||||||| ||||||| |||||||||||| || |||||||||||||||  ||||||||||||||||||| ||||||||||||    
10432164 ttcaaagggcagccattcattccaatttggcatgttgtcgaattttatacgctcaagggatggaaatggtaggaaggaagaat 10432246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 9 - 282
Target Start/End: Complemental strand, 10665658 - 10665394
Alignment:
9 aagcccatcgatattaattttctttactgncgacaaccaatgcaaagtgtttggctctgtttccaatagatgagaacacccttttattacaatttcttct 108  Q
    |||||||| ||| |||| ||| |||| || |||||||||||||||||||   ||  ||||||| |||||| ||      ||||  ||| |||||||||||    
10665658 aagcccattgattttaactttttttattgacgacaaccaatgcaaagtg---ggacctgtttctaatagacga------ccttcaatttcaatttcttct 10665568  T
109 atgcaaggaagatggctaggcaaatgtccctttagtttgggacaattacgtaacttcatagctcgaagttgaggaaaagcaaattttatgccttcaaagg 208  Q
    || ||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| |||| |||| ||||||||||||||||||||||||||||||    
10665567 atacaaggaagatggctaggcaaatgtccctttagttttggacaattacgtaactccatggctctaagtcgaggaaaagcaaattttatgccttcaaagg 10665468  T
209 gaagccattgattccaatttggtatattgtcgaattttatatactcaagggatggaaatggttggaaggaagaa 282  Q
    ||| ||||| ||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||    
10665467 gaatccattcattccaatttggtatgttgtcgaattttatacactcaagggatggaaatggttggaaggaagaa 10665394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 8 - 283
Target Start/End: Complemental strand, 10519624 - 10519352
Alignment:
8 caagcccatcgatattaattttctttactgncgacaaccaatgcaaagtgtttggctctgtttccaatagatgagaacacccttttattacaatttcttc 107  Q
    ||||||||| |||||| ||||| |||| ||  |||||||||||||||||   |||   ||||||||||||||||  ||| ||||||||||||||||||||    
10519624 caagcccattgatattcattttttttattgaagacaaccaatgcaaagtagatgg---tgtttccaatagatgaacacaaccttttattacaatttcttc 10519528  T
108 tatgcaaggaagatggctaggcaaatgtccctttagtttgggacaattacgtaacttcatagctcgaagttgaggaaaagcaaattttatgccttcaaag 207  Q
    |||| ||||||| | | | |||||||||||| ||||||  ||||||||||||||||| |||||   |||||||||||||||||||||||||||||| |||    
10519527 tatggaaggaaggttggtgggcaaatgtccccttagttctggacaattacgtaactttatagccttaagttgaggaaaagcaaattttatgccttcgaag 10519428  T
208 ggaagccattgattccaatttggtatattgtcgaattttatatactcaagggatggaaatggttggaaggaagaat 283  Q
    |||| ||||| |||||||||  | || ||||||||  |||||  |||||||||||| |||||||||||||||||||    
10519427 ggaatccattcattccaattgagcatgttgtcgaacattatacgctcaagggatgggaatggttggaaggaagaat 10519352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 18 - 283
Target Start/End: Original strand, 11779922 - 11780184
Alignment:
18 gatattaattttctttactgncgacaaccaatgcaaagtgtttggctctgtttccaatagatgagaacacccttttattacaatttcttctatgcaagga 117  Q
    |||||| ||||  |||| || ||||||||||||||||||   ||| |   ||||||||||||||||||| |||||||||||||||||||| |||||||||    
11779922 gatattcatttcttttattgacgacaaccaatgcaaagtagatggtt---tttccaatagatgagaacaaccttttattacaatttcttcgatgcaagga 11780018  T
118 agatggctaggcaaatgtccctttagtttgggacaattacgtaacttcatagctcgaagttgaggaaaagcaaattttatgccttcaaagggaagccatt 217  Q
    || | | |||||||||||||| ||||||  ||||||||||| |||| ||||| |   ||| ||||||| ||||||||||| ||||||||||||| |||||    
11780019 aggttggtaggcaaatgtccccttagttcaggacaattacgcaactccatagttttgagtcgaggaaatgcaaattttataccttcaaagggaaaccatt 11780118  T
218 gattccaatttggtatattgtcgaattttatatactcaagggatggaaatggttggaaggaagaat 283  Q
     |||||||||||| || ||||| |||||||||  ||| ||||||||||||||||||||||||||||    
11780119 cattccaatttggcatgttgtcaaattttataagctcgagggatggaaatggttggaaggaagaat 11780184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 7 - 283
Target Start/End: Original strand, 10373774 - 10374047
Alignment:
7 tcaagcccatcgatattaattttctttactgncgacaaccaatgcaaagtgtttggctctgtttccaatagatgagaacacccttttattacaatttctt 106  Q
    |||||||||| |||||| ||||  |||| ||  ||||||||||||| |||   |||   ||||||||||||||||||||| |||  ||||||||||||||    
10373774 tcaagcccattgatattcatttcttttattgaagacaaccaatgcagagtagatgg---tgtttccaatagatgagaacaacctgatattacaatttctt 10373870  T
107 ctatgcaaggaagatggctaggcaaatgtccctttagtttgggacaattacgtaacttcatagctcgaagttgaggaaaagcaaattttatgccttcaaa 206  Q
    ||||| ||||||| | | | |||||||||||| ||||||  ||||||||||||||||  |||||   |||| ||||||||||||||||||||||||||||    
10373871 ctatggaaggaaggttggtgggcaaatgtccccttagttctggacaattacgtaactctatagccttaagtcgaggaaaagcaaattttatgccttcaaa 10373970  T
207 gggaagccattgattccaatttggtatattgtcgaattttatatactcaagggatggaaatggttggaaggaagaat 283  Q
    ||||| ||||| |||||||||  | || |||||||| ||||||  |||||||||||| |||||||||||||||||||    
10373971 gggaatccattcattccaattgagcatgttgtcgaactttatacgctcaagggatgggaatggttggaaggaagaat 10374047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 18 - 283
Target Start/End: Complemental strand, 11771363 - 11771101
Alignment:
18 gatattaattttctttactgncgacaaccaatgcaaagtgtttggctctgtttccaatagatgagaacacccttttattacaatttcttctatgcaagga 117  Q
    |||||| ||||  |||| || ||||||||||||||||||   ||| |   ||||||||||||||||||| ||||| |||||||||||||| |||||||||    
11771363 gatattcatttcttttattgacgacaaccaatgcaaagtagatggtt---tttccaatagatgagaacaacctttgattacaatttcttcgatgcaagga 11771267  T
118 agatggctaggcaaatgtccctttagtttgggacaattacgtaacttcatagctcgaagttgaggaaaagcaaattttatgccttcaaagggaagccatt 217  Q
    || | | |||| |||||| || ||||||  ||||||||||| |||| ||||| |   ||| ||||||||||||||||||| |||||||| ||||||||||    
11771266 aggttggtaggaaaatgtacccttagttcaggacaattacgcaactccatagttttgagtcgaggaaaagcaaattttataccttcaaaaggaagccatt 11771167  T
218 gattccaatttggtatattgtcgaattttatatactcaagggatggaaatggttggaaggaagaat 283  Q
     |||||||||||| || ||||| |||||||||  ||| ||||||||||||||||||||||||||||    
11771166 cattccaatttggcatgttgtcaaattttataagctcgagggatggaaatggttggaaggaagaat 11771101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 8 - 283
Target Start/End: Complemental strand, 9851878 - 9851606
Alignment:
8 caagcccatcgatattaattttctttactgncgacaaccaatgcaaagtgtttggctctgtttccaatagatgagaacacccttttattacaatttcttc 107  Q
    ||||||||| |||||| ||||| |||| ||  ||||||||| ||| |||   |||   ||||||||||||||||||||| |||  |||||||||||||||    
9851878 caagcccattgatattcattttttttattgaagacaaccaacgcagagtagatgg---tgtttccaatagatgagaacaacctgatattacaatttcttc 9851782  T
108 tatgcaaggaagatggctaggcaaatgtccctttagtttgggacaattacgtaacttcatagctcgaagttgaggaaaagcaaattttatgccttcaaag 207  Q
    |||| ||||||| | | | ||||||| |||| ||||||| ||||||| ||||||||  || ||   ||||||||||||||||||||||||||||||||||    
9851781 tatggaaggaaggttggtgggcaaatatccccttagttttggacaatcacgtaactctattgccttaagttgaggaaaagcaaattttatgccttcaaag 9851682  T
208 ggaagccattgattccaatttggtatattgtcgaattttatatactcaagggatggaaatggttggaaggaagaat 283  Q
    |||| ||||| |||||||||  | || |||||||| ||||||  |||||||||||| |||||||||||||||||||    
9851681 ggaatccattcattccaattgagcatgttgtcgaactttatacgctcaagggatgggaatggttggaaggaagaat 9851606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 8 - 283
Target Start/End: Complemental strand, 10129064 - 10128792
Alignment:
8 caagcccatcgatattaattttctttactgncgacaaccaatgcaaagtgtttggctctgtttccaatagatgagaacacccttttattacaatttcttc 107  Q
    ||||||||| |||||| ||||| |||| ||  ||||||||||||| |||   |||   ||||||||||||||||||||| |||  |||||||||||||||    
10129064 caagcccattgatattcattttttttattgaagacaaccaatgcagagtagatgg---tgtttccaatagatgagaacaacctgatattacaatttcttc 10128968  T
108 tatgcaaggaagatggctaggcaaatgtccctttagtttgggacaattacgtaacttcatagctcgaagttgaggaaaagcaaattttatgccttcaaag 207  Q
    |||| ||||||| | | | |||||||||||| ||||||  |||||||| | |||||  |||||   ||||||||||||||||||||||||||||||||||    
10128967 tatggaaggaaggttggtgggcaaatgtccccttagttctggacaattccataactctatagccttaagttgaggaaaagcaaattttatgccttcaaag 10128868  T
208 ggaagccattgattccaatttggtatattgtcgaattttatatactcaagggatggaaatggttggaaggaagaat 283  Q
    |||| ||||| |||||||||    || |||||||| ||||||| |||||||||| | |||||||||||||||||||    
10128867 ggaatccattcattccaattgaccatgttgtcgaactttatatgctcaagggatcggaatggttggaaggaagaat 10128792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 8 - 281
Target Start/End: Complemental strand, 10079549 - 10079279
Alignment:
8 caagcccatcgatattaattttctttactgncgacaaccaatgcaaagtgtttggctctgtttccaatagatgagaacacccttttattacaatttcttc 107  Q
    |||| |||| |||||||||||| ||||||| || |||||||| ||||||   |||   ||||||||||||||  | ||| |||||||| | |||||||||    
10079549 caagaccattgatattaattttttttactgacggcaaccaatccaaagtaggtgg---tgtttccaatagattcgcacaaccttttatcataatttcttc 10079453  T
108 tatgcaaggaagatggctaggcaaatgtccctttagtttgggacaattacgtaacttcatagctcgaagttgaggaaaagcaaattttatgccttcaaag 207  Q
    |||||||||||| | |||||| ||||| ||||||||||  ||||||| |  ||||| ||||| || |||| |||||||| |||| ||||| |||||||||    
10079452 tatgcaaggaaggtcgctaggaaaatgcccctttagttcaggacaatcatctaactccatagttctaagtcgaggaaaaacaaaatttattccttcaaag 10079353  T
208 ggaagccattgattccaatttggtatattgtcgaattttatatactcaagggatggaaatggttggaaggaaga 281  Q
    ||||||||||||||||||||||| || ||||  ||||||||   ||||||||||||||||||||||||| ||||    
10079352 ggaagccattgattccaatttggcatgttgttaaattttatgcgctcaagggatggaaatggttggaagaaaga 10079279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 8 - 281
Target Start/End: Complemental strand, 10186519 - 10186249
Alignment:
8 caagcccatcgatattaattttctttactgncgacaaccaatgcaaagtgtttggctctgtttccaatagatgagaacacccttttattacaatttcttc 107  Q
    |||| |||| |||||||||||| ||||||| || |||||||| ||||||   |||   ||| ||||||||||  | ||| |||||||| | |||||||||    
10186519 caagaccattgatattaattttttttactgacggcaaccaatccaaagtaggtgg---tgtatccaatagattcgcacaaccttttatcataatttcttc 10186423  T
108 tatgcaaggaagatggctaggcaaatgtccctttagtttgggacaattacgtaacttcatagctcgaagttgaggaaaagcaaattttatgccttcaaag 207  Q
    |||||||||||| |  ||||||||||| ||||||||||  ||||||| |  ||||| ||||| || |||| |||||||| |||| ||||| |||||||||    
10186422 tatgcaaggaaggtcactaggcaaatgcccctttagttcaggacaatcatctaactccatagttctaagtcgaggaaaaacaaaatttattccttcaaag 10186323  T
208 ggaagccattgattccaatttggtatattgtcgaattttatatactcaagggatggaaatggttggaaggaaga 281  Q
    ||||||||||||||||||||||| || ||||  ||||||||   ||||||||||||||||||||||||| ||||    
10186322 ggaagccattgattccaatttggcatgttgttaaattttatgcgctcaagggatggaaatggttggaagaaaga 10186249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 8 - 283
Target Start/End: Complemental strand, 9840997 - 9840728
Alignment:
8 caagcccatcgatattaattttctttactgncgacaaccaatgcaaagtgtttggctctgtttccaatagatgagaacacccttttattacaatttcttc 107  Q
    ||||||||| |||||| ||||| |||| ||  ||||||||||||| |||   |||   ||||||||||||||||||||| |||  ||||||||||| |||    
9840997 caagcccattgatattcattttttttattgaagacaaccaatgcagagtagatgg---tgtttccaatagatgagaacaacctgatattacaattttttc 9840901  T
108 tatgcaaggaagatggctaggcaaatgtccctttagtttgggacaattacgtaacttcatagctcgaagttgaggaaaagcaaattttatgccttcaaag 207  Q
    |||| ||||||| | | | ||||||| |||| ||||||  |||||||| |||||||  |||||   ||||||||||||||||   |||||||||||||||    
9840900 tatggaaggaaggttggtgggcaaatatccccttagttctggacaattgcgtaactctatagccttaagttgaggaaaagca---tttatgccttcaaag 9840804  T
208 ggaagccattgattccaatttggtatattgtcgaattttatatactcaagggatggaaatggttggaaggaagaat 283  Q
    |||| ||||| |||||||||  | || |||||||| ||||||  |||||||||||| |||||||||||||||||||    
9840803 ggaatccattcattccaattgagcatgttgtcgaactttatacgctcaagggatgggaatggttggaaggaagaat 9840728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 7 - 283
Target Start/End: Complemental strand, 10034140 - 10033867
Alignment:
7 tcaagcccatcgatattaattttctttactgncgacaaccaatgcaaagtgtttggctctgtttccaatagatgagaacacccttttattacaatttctt 106  Q
    |||||||||| |||||| ||||| |||| ||  ||||||||||||| |||   |||   ||||||||||||||||||||| |||  ||||||||||| ||    
10034140 tcaagcccattgatattcattttttttattgaagacaaccaatgcagagtagatgg---tgtttccaatagatgagaacaacctgatattacaatttttt 10034044  T
107 ctatgcaaggaagatggctaggcaaatgtccctttagtttgggacaattacgtaacttcatagctcgaagttgaggaaaagcaaattttatgccttcaaa 206  Q
    ||||| ||||||| | | | |||||||||||| ||||||  |||||||||  |||||  |||||   |||| ||||||||||| ||||||||||||||||    
10034043 ctatggaaggaaggttggtgggcaaatgtccccttagttctggacaattatataactctatagccttaagtcgaggaaaagcacattttatgccttcaaa 10033944  T
207 gggaagccattgattccaatttggtatattgtcgaattttatatactcaagggatggaaatggttggaaggaagaat 283  Q
    ||||| ||||| |||||||||    || |||||||| ||||||  |||||||||| | |||||||||||||||||||    
10033943 gggaatccattcattccaattgaccatgttgtcgaactttatacgctcaagggatcggaatggttggaaggaagaat 10033867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 8 - 283
Target Start/End: Complemental strand, 10502722 - 10502450
Alignment:
8 caagcccatcgatattaattttctttactgncgacaaccaatgcaaagtgtttggctctgtttccaatagatgagaacacccttttattacaatttcttc 107  Q
    ||||||||| |||||||  ||| || | || ||||| ||||||||||||    |||  ||||||||||||||||| ||| |||| |||||||||||||||    
10502722 caagcccattgatattaccttttttcaatgacgacagccaatgcaaagta---ggcggtgtttccaatagatgagcacaaccttctattacaatttcttc 10502626  T
108 tatgcaaggaagatggctaggcaaatgtccctttagtttgggacaattacgtaacttcatagctcgaagttgaggaaaagcaaattttatgccttcaaag 207  Q
    |||| ||| ||| |||| ||| ||||  ||| | | ||  | ||||||| ||| ||||| |  |  |||  ||||||| ||||| ||  | |||||||||    
10502625 tatgaaagaaaggtggcaaggtaaattccccctcaattcagaacaattaagtatcttcagaattttaagacgaggaaaggcaaaattgtttccttcaaag 10502526  T
208 ggaagccattgattccaatttggtatattgtcgaattttatatactcaagggatggaaatggttggaaggaagaat 283  Q
    | ||||||||  ||||||||||| || |||   ||| ||||| |||||||||| ||||||||||||||||||||||    
10502525 gaaagccattccttccaatttggcatgttgaaaaatgttatacactcaagggagggaaatggttggaaggaagaat 10502450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 199 - 283
Target Start/End: Complemental strand, 10679389 - 10679305
Alignment:
199 ccttcaaagggaagccattgattccaatttggtatattgtcgaattttatatactcaagggatggaaatggttggaaggaagaat 283  Q
    |||||||| || ||||||| |||||||||||| ||  | |  ||| ||||| |||||||||| ||||||||||||||||||||||    
10679389 ccttcaaaagggagccattcattccaatttggcatgatttgaaatcttatacactcaagggacggaaatggttggaaggaagaat 10679305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 66 - 283
Target Start/End: Complemental strand, 10530731 - 10530514
Alignment:
66 tgtttccaatagatgagaacacccttttattacaatttcttctatgcaaggaagatggctaggcaaatgtccctttagtttgggacaattacgtaacttc 165  Q
    ||||||||||||| ||| ||| |||| ||||  ||||||||||||| |||  || |||||||| ||||||||| | | ||  |||||||||  |||||      
10530731 tgtttccaatagacgagcacaaccttctatttgaatttcttctatggaagataggtggctaggaaaatgtcccctaaattctggacaattatataactca 10530632  T
166 atagctcgaagttgaggaaaagcaaattttatgccttcaaagggaagccattgattccaatttggtatattgtcgaattttatatactcaagggatggaa 265  Q
    | || |  |||    |||||||||||  |  | |||||||| || ||||||| |||||||||||| ||  | |  ||| |||||  ||||||||| ||||    
10530631 agagttttaagacatggaaaagcaaagctgtttccttcaaaagggagccattcattccaatttggcatgatttgaaatcttatacgctcaagggacggaa 10530532  T
266 atggttggaaggaagaat 283  Q
    ||||||||||||||||||    
10530531 atggttggaaggaagaat 10530514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 69 - 138
Target Start/End: Original strand, 11129020 - 11129089
Alignment:
69 ttccaatagatgagaacacccttttattacaatttcttctatgcaaggaagatggctaggcaaatgtccc 138  Q
    |||||| ||||||| ||| |||||  |||||| |||||||||| |||  |||||||||||||||| ||||    
11129020 ttccaacagatgaggacaacctttatttacaaattcttctatggaagagagatggctaggcaaatttccc 11129089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 100 - 152
Target Start/End: Complemental strand, 13163027 - 13162975
Alignment:
100 atttcttctatgcaaggaagatggctaggcaaatgtccctttagtttgggaca 152  Q
    ||||| |||||  ||||||||  |||||||||||||||||||||||| |||||    
13163027 atttcatctattgaaggaagactgctaggcaaatgtccctttagtttaggaca 13162975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 100 - 152
Target Start/End: Complemental strand, 13334951 - 13334899
Alignment:
100 atttcttctatgcaaggaagatggctaggcaaatgtccctttagtttgggaca 152  Q
    ||||| |||||  ||||||||  |||||||||||||||||||||||| |||||    
13334951 atttcgtctattgaaggaagactgctaggcaaatgtccctttagtttaggaca 13334899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 8 - 279
Target Start/End: Complemental strand, 26909027 - 26908759
Alignment:
8 caagcccatcgatattaattttctttactgncgacaaccaatgcaaagtgtttggctctgtttccaatagatgagaacacccttttattacaatttcttc 107  Q
    ||||||||| |||||||||||||  ||  | ||||| |||||| |||||   |||   |||||||||||||||| | || ||||||||||||||||||||    
26909027 caagcccatggatattaattttcggtatggacgacacccaatgtaaagtagatgg---tgtttccaatagatgatagcaaccttttattacaatttcttc 26908931  T
108 tatgcaaggaagatggctaggcaaatgtccctttagtttgggacaattacgtaacttcatagctcgaagttgaggaaaagcaaattttatgccttcaaag 207  Q
    |||||||||||| | |||||||||| |||| |||||||| ||||||||| | ||||  |||| ||  ||| ||||||||| ||| || || |||||||||    
26908930 tatgcaaggaaggttgctaggcaaaagtccttttagttttggacaattatgcaactcaatagttctgagtcgaggaaaagaaaaattcattccttcaaag 26908831  T
208 ggaagccattgattccaatttggtatattgtcgaattttatatactcaagggatggaaatggttggaaggaa 279  Q
    ||||||||||||||||||||||| || ||||  |||||||||  |||||||||| |||||||||||||||||    
26908830 ggaagccattgattccaatttggcatgttgttaaattttatacgctcaagggattgaaatggttggaaggaa 26908759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0083 (Bit Score: 103; Significance: 3e-51; HSPs: 1)
Name: scaffold0083
Description:

Target: scaffold0083; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 8 - 283
Target Start/End: Original strand, 55532 - 55804
Alignment:
8 caagcccatcgatattaattttctttactgncgacaaccaatgcaaagtgtttggctctgtttccaatagatgagaacacccttttattacaatttcttc 107  Q
    ||||||||| |||||| ||| | |||| ||  ||||||||||||| |||   |||   ||||||||||||||||||||| |||  |||||||||||||||    
55532 caagcccattgatattcattatttttattgaagacaaccaatgcagagtagatgg---tgtttccaatagatgagaacaacctgatattacaatttcttc 55628  T
108 tatgcaaggaagatggctaggcaaatgtccctttagtttgggacaattacgtaacttcatagctcgaagttgaggaaaagcaaattttatgccttcaaag 207  Q
    |||| ||||||| | | | |||||||||||| ||||||  ||||||| ||||||||  || ||   ||||||||||||||||||||||||||||||||||    
55629 tatggaaggaaggttggtgggcaaatgtccccttagttctggacaatcacgtaactctattgccttaagttgaggaaaagcaaattttatgccttcaaag 55728  T
208 ggaagccattgattccaatttggtatattgtcgaattttatatactcaagggatggaaatggttggaaggaagaat 283  Q
    |||| ||||| |||||||||    || |||||||| |||||| ||||||||||| | |||||||||||||||||||    
55729 ggaatccattcattccaattgaacatgttgtcgaactttataaactcaagggataggaatggttggaaggaagaat 55804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 57; Significance: 7e-24; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 18 - 283
Target Start/End: Complemental strand, 11487164 - 11486902
Alignment:
18 gatattaattttctttactgncgacaaccaatgcaaagtgtttggctctgtttccaatagatgagaacacccttttattacaatttcttctatgcaagga 117  Q
    ||||| |||||| |||| || |||||||||||||||||    |||   ||||||||| ||||| | ||| ||| ||||   ||||| |||||||||||||    
11487164 gatatcaattttttttattgacgacaaccaatgcaaagcagatgg---tgtttccaaaagatgggcacaacctgttatattaattttttctatgcaagga 11487068  T
118 agatggctaggcaaatgtccctttagtttgggacaattacgtaacttcatagctcgaagttgaggaaaagcaaattttatgccttcaaagggaagccatt 217  Q
    || |||||||||||||||||| |||| |   ||||| || ||||||  | || || |||  ||||||||| |||   | |||||||||| ||||||||||    
11487067 aggtggctaggcaaatgtccccttagctcatgacaactatgtaactcaagagttctaagacgaggaaaagaaaaaaatttgccttcaaaaggaagccatt 11486968  T
218 gattccaatttggtatattgtcgaattttatatactcaagggatggaaatggttggaaggaagaat 283  Q
      ||||||||| | || ||| | ||| ||||| | |||||||||| ||||||||||||||||||||    
11486967 ccttccaattttgcatgttgacaaatgttatacattcaagggatgaaaatggttggaaggaagaat 11486902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 66 - 283
Target Start/End: Original strand, 44955662 - 44955879
Alignment:
66 tgtttccaatagatgagaacacccttttattacaatttcttctatgcaaggaagatggctaggcaaatgtccctttagtttgggacaattacgtaacttc 165  Q
    ||||||||||||||||| |||  |||||||| |||||||||||||| ||| |||||| || ||||| |||| | |  |||| ||||||| | ||||| ||    
44955662 tgtttccaatagatgagcacaatcttttatttcaatttcttctatggaagaaagatgacttggcaagtgtcgcctatgttttggacaatcatgtaacgtc 44955761  T
166 atagctcgaagttgaggaaaagcaaattttatgccttcaaagggaagccattgattccaatttggtatattgtcgaattttatatactcaagggatggaa 265  Q
    | |  || |||  ||||||||||||| ||  | |||| |||||||| ||| |  ||||||||||  || ||||  | ||| |||| ||||||||| || |    
44955762 aaaattctaagacgaggaaaagcaaaattgcttcctttaaagggaatccactccttccaatttgacattttgtgaagtttgatatgctcaagggacggga 44955861  T
266 atggttggaaggaagaat 283  Q
    ||||||||||||| ||||    
44955862 atggttggaaggaggaat 44955879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 179 - 283
Target Start/End: Original strand, 17851024 - 17851128
Alignment:
179 gaggaaaagcaaattttatgccttcaaagggaagccattgattccaatttggtatattgtcgaattttatatactcaagggatggaaatggttggaagga 278  Q
    ||||||||||||| || |||||| |||||||||||||||  ||||||||||| || |||   ||  ||| | |||||||||| ||||||||||| |||||    
17851024 gaggaaaagcaaaattgatgcctacaaagggaagccattccttccaatttggcatgttgcgaaacattaaacactcaagggacggaaatggttgaaagga 17851123  T
279 agaat 283  Q
    |||||    
17851124 agaat 17851128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 98 - 145
Target Start/End: Complemental strand, 827942 - 827895
Alignment:
98 caatttcttctatgcaaggaagatggctaggcaaatgtccctttagtt 145  Q
    ||||||| |||||| |||||||||||||||||||||||||||| ||||    
827942 caatttcctctatggaaggaagatggctaggcaaatgtcccttcagtt 827895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 29; Significance: 0.0000004; HSPs: 2)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 100 - 152
Target Start/End: Original strand, 143961 - 144013
Alignment:
100 atttcttctatgcaaggaagatggctaggcaaatgtccctttagtttgggaca 152  Q
    ||||| |||||  ||||||||  |||||||||||||||||||||||| |||||    
143961 atttcatctattgaaggaagactgctaggcaaatgtccctttagtttaggaca 144013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 100 - 152
Target Start/End: Original strand, 152266 - 152318
Alignment:
100 atttcttctatgcaaggaagatggctaggcaaatgtccctttagtttgggaca 152  Q
    ||||| |||||  ||||||||  |||||||||||||||||||||||| |||||    
152266 atttcatctattgaaggaagactgctaggcaaatgtccctttagtttaggaca 152318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 106038 times since January 2019
Visitors: 1319