View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk81-8 (Length: 936)

Name: R108-tnk81-8
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk81-8
R108-tnk81-8
[»] chr8 (12 HSPs)
chr8 (408-905)||(8706565-8707062)
chr8 (9-407)||(8706133-8706530)
chr8 (546-736)||(8691930-8692121)
chr8 (658-736)||(14384633-14384711)
chr8 (338-395)||(8691850-8691907)
chr8 (165-316)||(8744915-8745066)
chr8 (7-85)||(8724900-8724978)
chr8 (840-905)||(8692132-8692197)
chr8 (7-83)||(8744741-8744817)
chr8 (830-889)||(14384573-14384632)
chr8 (902-936)||(8706096-8706130)
chr8 (141-202)||(8691629-8691690)


Alignment Details
Target: chr8 (Bit Score: 490; Significance: 0; HSPs: 12)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 490; E-Value: 0
Query Start/End: Original strand, 408 - 905
Target Start/End: Original strand, 8706565 - 8707062
Alignment:
408 tattaaagtgtgtatctcttattagtgaaccatccattgctgtgacatcattttagcaatgcttggtgattttcttttatagattgtgaaaaagtacatg 507  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8706565 tattaaagtgtgtatctcttattagtgaaccatccattgctgtgacatcattttagcaatgcttggtgattttcttttatagattgtgaaaaagtacatg 8706664  T
508 gatgaaatgaaatatctaggttgagttagttttgatgtttttctttaatagactcagaagtactcttttctttatactttgacgtggctgttattctctt 607  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
8706665 gatgaaatgaaatatctaggttgagttagttttgatgtttttctttaatagactcagaagtactcttttctttatactttgatgtggctgttattctctt 8706764  T
608 ccttttgaaatgctatagattgaactttcataatgtttattttcttctacaattttacagtgtggcgatattcttgatacttcaacggcatttcttgaac 707  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8706765 ccttttgaaatgctatagattgaactttcataatgtttattttcttctacaattttacagtgtggcgatattcttgatacttcaacggcatttcttgaac 8706864  T
708 atcctagttcaggcgaatactgtgcatcaaaattgttgaaatcaacacatggtaatgttcatggaagcacctgttttcaatctttaaagaacggtgaaat 807  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8706865 atcctagttcaggcgaatactgtgcatcaaaattgttgaaatcaacacatggtaatgttcatggaagcacctgttttcaatctttaaagaacggtgaaat 8706964  T
808 tgaagacaacaacgagagtacctttcaagattattttgggggattagaggcatcctcttgtgattcaactacagatatacctttggagatgatcaatt 905  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
8706965 tgaagacaacaacgagagtacctttcaagattattttgggggattagaggcatcctcttgtgattcaactgcagatatacctttggagatgatcaatt 8707062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 375; E-Value: 0
Query Start/End: Original strand, 9 - 407
Target Start/End: Original strand, 8706133 - 8706530
Alignment:
9 atagaaattttgagaacaaagttttggatttaaacctttctacatgagacatgctgagaacttatatatgttttataggtgagtgaaactttgccagaaa 108  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||    
8706133 atagaaattttgagaacaaagttttggatttaagcctttctacatgaaacatgctgagaacttatatttgttttataggtgagtgaaactttgccagaaa 8706232  T
109 taaatatggaatcaatatttcaggcacaggaagaaaatttatttcctttctcaccacaacagtcttcaatctctgaaaatgagcaggaagtatcaatccc 208  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8706233 taaatatggaatcaatatttcaggcacaggaagaaaatttctttcctttctcaccacaacagtcttcaatctctgaaaatgagcaggaagtatcaatccc 8706332  T
209 aaactcacgacttcacgatgcctattttagaaatgacaacatcattgttcagagtccatttaaaactattgaagaggaagataagttcatcagttcaatg 308  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8706333 aaactcacgacttcacgatgcctattttagaaatgacaacatcattgttcagagtccatttaaaactattgaagaggaagataagttcatcagttcaatg 8706432  T
309 attattgacggggatttggacagcggtcatgtccagtccgagtcgttgaaaatggtctactatggaagcagtgacacagatgctgaagtaagtctctac 407  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
8706433 attattgacggggatttggacagcggtcatgtccagtccgagtcgttgaaaatggtctactatggaagcagtgacacagatgctgaagt-agtctctac 8706530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 88; E-Value: 8e-42
Query Start/End: Original strand, 546 - 736
Target Start/End: Original strand, 8691930 - 8692121
Alignment:
546 ttttctttaatagactcagaagtactcttttctttatactttgacgtggctgttattctcttccttttgaaatgcta-tagattgaactttcataatgtt 644  Q
    |||||||| ||| | |||||||| || ||||||| ||||| ||| || |||||| |||||||||||||||||||||| |||| || | ||||||| ||||    
8691930 ttttctttgatacattcagaagttcttttttcttcatactgtgatgtagctgtttttctcttccttttgaaatgctactagaatggaatttcatattgtt 8692029  T
645 tattttcttctacaattttacagtgtggcgatattcttgatacttcaacggcatttcttgaacatcctagttcaggcgaatactgtgcatca 736  Q
    |||||||||||| ||||||||||||| || || |||| |||||||||||||| |||||||| |||||||| ||| ||||||||| |||||||    
8692030 tattttcttctaaaattttacagtgtcgcaatgttctggatacttcaacggcgtttcttgagcatcctagctcaagcgaatactatgcatca 8692121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 658 - 736
Target Start/End: Complemental strand, 14384711 - 14384633
Alignment:
658 aattttacagtgtggcgatattcttgatacttcaacggcatttcttgaacatcctagttcaggcgaatactgtgcatca 736  Q
    ||||||||||| |||| || |||| |||||||||||||| ||||||||||||||||||||||||||||||| |||||||    
14384711 aattttacagtatggcaatgttctggatacttcaacggcttttcttgaacatcctagttcaggcgaatactatgcatca 14384633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 338 - 395
Target Start/End: Original strand, 8691850 - 8691907
Alignment:
338 tgtccagtccgagtcgttgaaaatggtctactatggaagcagtgacacagatgctgaa 395  Q
    |||||||||| ||||||||| |||| || |||||||||||||||||||||||||||||    
8691850 tgtccagtccaagtcgttgagaatgatcgactatggaagcagtgacacagatgctgaa 8691907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 165 - 316
Target Start/End: Original strand, 8744915 - 8745066
Alignment:
165 caacagtcttcaatctctgaaaatgagcaggaagtatcaatcccaaactcacgacttcacgatgcctattttagaaatgacaacatcattgttcagagtc 264  Q
    ||||| |||||||||| ||||||||||| ||||||||   || ||||||||| | |||| |  |  ||||||||||||||  ||||  || |||||||||    
8744915 caacaatcttcaatctatgaaaatgagcgggaagtatatttctcaaactcacaatttcaaggagattattttagaaatgaagacatggttattcagagtc 8745014  T
265 catttaaaactattgaagaggaagataagttcatcagttcaatgattattga 316  Q
    | ||| |||| | |||||||||| |||| ||||| | |||||||||| ||||    
8745015 cctttgaaaccaatgaagaggaaaataacttcattaattcaatgattgttga 8745066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 85
Target Start/End: Original strand, 8724900 - 8724978
Alignment:
7 tgatagaaattttgagaacaaagttttggatttaaacctttctacatgagacatgctgagaacttatatatgttttata 85  Q
    ||||||||||||| | | | |||| |||| |||| ||||||| |||||| ||||||||||||||||||  |||||||||    
8724900 tgatagaaattttcaaagccaagtcttggttttacacctttccacatgaaacatgctgagaacttatacttgttttata 8724978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 840 - 905
Target Start/End: Original strand, 8692132 - 8692197
Alignment:
840 attttgggggattagaggcatcctcttgtgattcaactacagatatacctttggagatgatcaatt 905  Q
    |||| |||||||| ||||||||||||||||| ||| || |||||| |||| | |||||||||||||    
8692132 atttcgggggattggaggcatcctcttgtgactcatctgcagataaacctctagagatgatcaatt 8692197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 7 - 83
Target Start/End: Original strand, 8744741 - 8744817
Alignment:
7 tgatagaaattttgagaacaaagttttggatttaaacctttctacatgagacatgctgagaacttatatatgtttta 83  Q
    ||||||||||||||| ||||||||||||| |||| ||  ||  |||||| ||||||| ||||||||||  |||||||    
8744741 tgatagaaattttgaaaacaaagttttggctttacacaatttcacatgaaacatgctaagaacttatacttgtttta 8744817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 830 - 889
Target Start/End: Complemental strand, 14384632 - 14384573
Alignment:
830 tttcaagattattttgggggattagaggcatcctcttgtgattcaactacagatatacct 889  Q
    |||| |||| |||| |||||||| ||||||||||||||||| |||||| |||||| ||||    
14384632 tttcgagatgatttcgggggattggaggcatcctcttgtgactcaactgcagataaacct 14384573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 902 - 936
Target Start/End: Original strand, 8706096 - 8706130
Alignment:
902 aattcctgatgtaaggagttcatccttggtaaatg 936  Q
    |||||||||||||||||||||||||||| ||||||    
8706096 aattcctgatgtaaggagttcatccttgataaatg 8706130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 141 - 202
Target Start/End: Original strand, 8691629 - 8691690
Alignment:
141 gaaaatttatttcctttctcaccacaacagtcttcaatctctgaaaatgagcaggaagtatc 202  Q
    |||||||  |||||||||||| || | ||| |||||||||||||||||||| | ||||||||    
8691629 gaaaattactttcctttctcaacataccagccttcaatctctgaaaatgagaacgaagtatc 8691690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 360536 times since January 2019
Visitors: 484