View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk88-15 (Length: 777)

Name: R108-tnk88-15
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk88-15
R108-tnk88-15
[»] chr1 (6 HSPs)
chr1 (1-522)||(44141131-44141652)
chr1 (1-522)||(44128504-44129025)
chr1 (1-522)||(44132709-44133230)
chr1 (517-777)||(44128248-44128508)
chr1 (517-777)||(44132453-44132713)
chr1 (517-777)||(44140875-44141135)
[»] chr7 (17 HSPs)
chr7 (4-522)||(46706659-46707177)
chr7 (1-522)||(5310327-5310848)
chr7 (9-522)||(5289368-5289881)
chr7 (9-522)||(5315049-5315562)
chr7 (9-522)||(5302434-5302947)
chr7 (9-522)||(5284246-5284759)
chr7 (518-620)||(5290081-5290183)
chr7 (518-620)||(5302132-5302234)
chr7 (518-620)||(5309769-5309871)
chr7 (518-620)||(5283944-5284046)
chr7 (518-620)||(5314586-5314688)
chr7 (702-774)||(46707179-46707251)
chr7 (728-777)||(5310282-5310331)
chr7 (728-776)||(5284193-5284241)
chr7 (728-776)||(5314996-5315044)
chr7 (728-776)||(5289886-5289934)
chr7 (728-776)||(5302381-5302429)
[»] chr5 (16 HSPs)
chr5 (1-520)||(1504907-1505426)
chr5 (1-522)||(1492098-1492619)
chr5 (6-522)||(1482128-1482644)
chr5 (9-522)||(1477937-1478450)
chr5 (1-522)||(1509054-1509575)
chr5 (46-522)||(1499215-1499691)
chr5 (9-520)||(1486608-1487119)
chr5 (518-625)||(1504435-1504542)
chr5 (521-619)||(1491674-1491772)
chr5 (672-777)||(1504807-1504911)
chr5 (521-620)||(1477673-1477772)
chr5 (521-624)||(1481784-1481887)
chr5 (518-620)||(1485517-1485621)
chr5 (518-618)||(1496881-1496981)
chr5 (728-767)||(1482078-1482117)
chr5 (728-767)||(1477884-1477923)
[»] chr2 (3 HSPs)
chr2 (42-520)||(24163463-24163941)
chr2 (521-620)||(24165436-24165535)
chr2 (732-773)||(24163982-24164023)
[»] chr3 (5 HSPs)
chr3 (6-520)||(37863063-37863577)
chr3 (13-517)||(37859040-37859544)
chr3 (117-344)||(39030117-39030344)
chr3 (521-616)||(37863716-37863811)
chr3 (560-616)||(37859726-37859782)
[»] chr8 (1 HSPs)
chr8 (1-442)||(35250741-35251182)


Alignment Details
Target: chr1 (Bit Score: 446; Significance: 0; HSPs: 6)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 446; E-Value: 0
Query Start/End: Original strand, 1 - 522
Target Start/End: Original strand, 44141131 - 44141652
Alignment:
1 cagaggagattttgaaagagaatcctagtgtttgtgagtacatggcaccttcattggatgctaggcaagacatggtgggggtagaggtacctagattagg 100  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||    
44141131 cagaggagattttgaaagagaatcctagtgtttgtgaatacatggcaccttcattggatgctaggcaagacatggtggtggtagaggtacctagactagg 44141230  T
101 gaaggaggctgcagcgaaggctataaaagaatggggtcaaccaaagtcaaagattactcacttaatcgtttgcaccacgagtggtgctgacatgcctgaa 200  Q
    |||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||  |||||||||| |    
44141231 gaaggaggctgcagtgaaggccataaaagaatggggtcaaccaaagtcaaagattactcacttgatcgtttgcaccacaagtggtgtagacatgcctgga 44141330  T
201 actgattaccaactcacaaaactcttaggtcttcgtccatatgtgaaaaggtatatgatgtaccaacaaggttgctttgccggaggcacggtgcttcgtt 300  Q
     |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||    
44141331 gctgattaccaactcacaaaactcttaggtcttcgcccatatgtgaaaaggtatatgatgtaccaacaaggttgctttgcaggaggcacggtccttcgtt 44141430  T
301 tggctaaagatttggcggagaacaacaaaggtgctcgtgtgttggttgtttgttctgaagtcactgcagttacatttcgcggccctagtgatactcactt 400  Q
    ||||||||||||| || || ||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||    
44141431 tggctaaagatttagctgaaaacaacaaaggtgctcgtgtgttggttgtctgttctgaagtcactgcagtcacatttcgcggccctagtgatactcactt 44141530  T
401 ggacagccttgttggacaagcactatttggagatggagctgctgcactaattgttggttcagatccagtaccagaaattgagaaaccaatatttgagatg 500  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44141531 ggacagccttgttggacaagcactatttggagatggagctgctgcactaattgttggttcagatccagtaccagaaattgagaaaccaatatttgagatg 44141630  T
501 gtttggactgcacaaacaattg 522  Q
    ||||||||||||||||||||||    
44141631 gtttggactgcacaaacaattg 44141652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 438; E-Value: 0
Query Start/End: Original strand, 1 - 522
Target Start/End: Original strand, 44128504 - 44129025
Alignment:
1 cagaggagattttgaaagagaatcctagtgtttgtgagtacatggcaccttcattggatgctaggcaagacatggtgggggtagaggtacctagattagg 100  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||    
44128504 cagaggagattttgaaagagaatcctagtgtttgtgaatacatggcaccttcattggatgctaggcaagacatggtggtggtagaggtacctagactagg 44128603  T
101 gaaggaggctgcagcgaaggctataaaagaatggggtcaaccaaagtcaaagattactcacttaatcgtttgcaccacgagtggtgctgacatgcctgaa 200  Q
    |||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||  |||||||||| |    
44128604 gaaggaggctgcagtgaaggccataaaagaatggggtcaaccaaagtcaaagattactcacttgatcgtttgcaccacaagtggtgtagacatgcctgga 44128703  T
201 actgattaccaactcacaaaactcttaggtcttcgtccatatgtgaaaaggtatatgatgtaccaacaaggttgctttgccggaggcacggtgcttcgtt 300  Q
     |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||    
44128704 gctgattaccaactcacaaaactcttaggtcttcgcccatatgtgaaaaggtatatgatgtaccaacaaggttgctttgcaggaggcacggtccttcgtt 44128803  T
301 tggctaaagatttggcggagaacaacaaaggtgctcgtgtgttggttgtttgttctgaagtcactgcagttacatttcgcggccctagtgatactcactt 400  Q
    ||||||||||||| || || ||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||    
44128804 tggctaaagatttagctgaaaacaacaaaggtgctcgtgtgttggttgtctgttctgaagtcactgcagtcacatttcgcggccctagtgatactcactt 44128903  T
401 ggacagccttgttggacaagcactatttggagatggagctgctgcactaattgttggttcagatccagtaccagaaattgagaaaccaatatttgagatg 500  Q
    |||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44128904 ggacagccttgttggacaggccctatttggagatggagctgctgcactaattgttggttcagatccagtaccagaaattgagaaaccaatatttgagatg 44129003  T
501 gtttggactgcacaaacaattg 522  Q
    ||||||||||||||||||||||    
44129004 gtttggactgcacaaacaattg 44129025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 438; E-Value: 0
Query Start/End: Original strand, 1 - 522
Target Start/End: Original strand, 44132709 - 44133230
Alignment:
1 cagaggagattttgaaagagaatcctagtgtttgtgagtacatggcaccttcattggatgctaggcaagacatggtgggggtagaggtacctagattagg 100  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||    
44132709 cagaggagattttgaaagagaatcctagtgtttgtgaatacatggcaccttcattggatgctaggcaagacatggtggtggtagaggtacctagactagg 44132808  T
101 gaaggaggctgcagcgaaggctataaaagaatggggtcaaccaaagtcaaagattactcacttaatcgtttgcaccacgagtggtgctgacatgcctgaa 200  Q
    |||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||  |||||||||| |    
44132809 gaaggaggctgcagtgaaggccataaaagaatggggtcaaccaaagtcaaagattactcacttgatcgtttgcaccacaagtggtgtagacatgcctgga 44132908  T
201 actgattaccaactcacaaaactcttaggtcttcgtccatatgtgaaaaggtatatgatgtaccaacaaggttgctttgccggaggcacggtgcttcgtt 300  Q
     |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||    
44132909 gctgattaccaactcacaaaactcttaggtcttcgcccatatgtgaaaaggtatatgatgtaccaacaaggttgctttgcaggaggcacggtccttcgtt 44133008  T
301 tggctaaagatttggcggagaacaacaaaggtgctcgtgtgttggttgtttgttctgaagtcactgcagttacatttcgcggccctagtgatactcactt 400  Q
    ||||||||||||| || || ||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||    
44133009 tggctaaagatttagctgaaaacaacaaaggtgctcgtgtgttggttgtctgttctgaagtcactgcagtcacatttcgcggccctagtgatactcactt 44133108  T
401 ggacagccttgttggacaagcactatttggagatggagctgctgcactaattgttggttcagatccagtaccagaaattgagaaaccaatatttgagatg 500  Q
    |||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44133109 ggacagccttgttggacaggccctatttggagatggagctgctgcactaattgttggttcagatccagtaccagaaattgagaaaccaatatttgagatg 44133208  T
501 gtttggactgcacaaacaattg 522  Q
    ||||||||||||||||||||||    
44133209 gtttggactgcacaaacaattg 44133230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 517 - 777
Target Start/End: Original strand, 44128248 - 44128508
Alignment:
517 caattgtgttgaacaaagcacatatcctgatttctactttaaaatcacaaatagtgaacacaagactgaactcaaagagaaattccaacgcatgtgtaag 616  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44128248 caattgtgttgaacaaagcacatatcctgatttctacttcaaaatcacaaatagtgaacacaagactgaactcaaagagaaattccaacgcatgtgtaag 44128347  T
617 tattttttccctctaccttagatactttccatttaaatatattttgctatctttacattggtttcttatcacccaagttttgttgaactaatatcatctt 716  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
44128348 tattttttccctctaccttagatactttccatttaaatatattttgctatctttacattggtttcttaacacccaagttttgttgaactaatatcatctt 44128447  T
717 ttcataattcccttcaggtgataaatctatgatcaagaggagatatatgtacctaacagag 777  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44128448 ttcataattcccttcaggtgataaatctatgatcaagaggagatatatgtacctaacagag 44128508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 517 - 777
Target Start/End: Original strand, 44132453 - 44132713
Alignment:
517 caattgtgttgaacaaagcacatatcctgatttctactttaaaatcacaaatagtgaacacaagactgaactcaaagagaaattccaacgcatgtgtaag 616  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44132453 caattgtgttgaacaaagcacatatcctgatttctacttcaaaatcacaaatagtgaacacaagactgaactcaaagagaaattccaacgcatgtgtaag 44132552  T
617 tattttttccctctaccttagatactttccatttaaatatattttgctatctttacattggtttcttatcacccaagttttgttgaactaatatcatctt 716  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
44132553 tattttttccctctaccttagatactttccatttaaatatattttgctatctttacattggtttcttaacacccaagttttgttgaactaatatcatctt 44132652  T
717 ttcataattcccttcaggtgataaatctatgatcaagaggagatatatgtacctaacagag 777  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44132653 ttcataattcccttcaggtgataaatctatgatcaagaggagatatatgtacctaacagag 44132713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 517 - 777
Target Start/End: Original strand, 44140875 - 44141135
Alignment:
517 caattgtgttgaacaaagcacatatcctgatttctactttaaaatcacaaatagtgaacacaagactgaactcaaagagaaattccaacgcatgtgtaag 616  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44140875 caattgtgttgaacaaagcacatatcctgatttctacttcaaaatcacaaatagtgaacacaagactgaactcaaagagaaattccaacgcatgtgtaag 44140974  T
617 tattttttccctctaccttagatactttccatttaaatatattttgctatctttacattggtttcttatcacccaagttttgttgaactaatatcatctt 716  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
44140975 tattttttccctctaccttagatactttccatttaaatatattttgctatctttacattggtttcttaacacccaagttttgttgaactaatatcatctt 44141074  T
717 ttcataattcccttcaggtgataaatctatgatcaagaggagatatatgtacctaacagag 777  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44141075 ttcataattcccttcaggtgataaatctatgatcaagaggagatatatgtacctaacagag 44141135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 387; Significance: 0; HSPs: 17)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 387; E-Value: 0
Query Start/End: Original strand, 4 - 522
Target Start/End: Complemental strand, 46707177 - 46706659
Alignment:
4 aggagattttgaaagagaatcctagtgtttgtgagtacatggcaccttcattggatgctaggcaagacatggtgggggtagaggtacctagattagggaa 103  Q
    |||||||||||||||||||||| ||||||||||| || |||||||||||||||||||| |||||||||||||||| |||||||||||||||| |||||||    
46707177 aggagattttgaaagagaatcccagtgtttgtgaatatatggcaccttcattggatgccaggcaagacatggtggtggtagaggtacctagactagggaa 46707078  T
104 ggaggctgcagcgaaggctataaaagaatggggtcaaccaaagtcaaagattactcacttaatcgtttgcaccacgagtggtgctgacatgcctgaaact 203  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || |||||||  |||||||||| | ||    
46707077 ggaggctgcagtgaaggctataaaagaatggggtcaaccaaagtcaaagattacccacttaatcgtttgcactactagtggtgtagacatgcctggagct 46706978  T
204 gattaccaactcacaaaactcttaggtcttcgtccatatgtgaaaaggtatatgatgtaccaacaaggttgctttgccggaggcacggtgcttcgtttgg 303  Q
    ||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||    
46706977 gattaccaactcacaaaactcttcggtcttcgcccatatgtgaaaaggtatatgatgtaccaacaaggttgctttgcaggaggcacggggcttcgtttgg 46706878  T
304 ctaaagatttggcggagaacaacaaaggtgctcgtgtgttggttgtttgttctgaagtcactgcagttacatttcgcggccctagtgatactcacttgga 403  Q
    |||| |||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||    
46706877 ctaacgatttggctgagaacaacaaaggtgcccgtgtattggttgtttgttctgaagtcactgcagtcacattccgcggccctagtgatactcacttgga 46706778  T
404 cagccttgttggacaagcactatttggagatggagctgctgcactaattgttggttcagatccagtaccagaaattgagaaaccaatatttgagatggtt 503  Q
    |||||||||||| |||||||| |||||||   ||||||||||||| ||||||||||| |||||||||||||||||||||||||| |||||||||||||||    
46706777 cagccttgttgggcaagcactgtttggagtcagagctgctgcacttattgttggttctgatccagtaccagaaattgagaaacctatatttgagatggtt 46706678  T
504 tggactgcacaaacaattg 522  Q
    |||||| ||||||||||||    
46706677 tggacttcacaaacaattg 46706659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 386; E-Value: 0
Query Start/End: Original strand, 1 - 522
Target Start/End: Original strand, 5310327 - 5310848
Alignment:
1 cagaggagattttgaaagagaatcctagtgtttgtgagtacatggcaccttcattggatgctaggcaagacatggtgggggtagaggtacctagattagg 100  Q
    ||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| ||||    
5310327 cagaggagattttgaaagaaaatcctagtgtttgtgaatacatggcaccttcattggatgcaaggcaagacatggtggtggtagaggtacctagactagg 5310426  T
101 gaaggaggctgcagcgaaggctataaaagaatggggtcaaccaaagtcaaagattactcacttaatcgtttgcaccacgagtggtgctgacatgcctgaa 200  Q
     ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||  |||||||||| |    
5310427 aaaggaggctgcagtgaaggctataaaagaatggggtcaaccaaagtcaaagattactcacttaatcgtttgcaccacaagtggtgtagacatgcctgga 5310526  T
201 actgattaccaactcacaaaactcttaggtcttcgtccatatgtgaaaaggtatatgatgtaccaacaaggttgctttgccggaggcacggtgcttcgtt 300  Q
     ||||||| ||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| || ||||| || ||||||||||||||||    
5310527 gctgattatcaactcacaaaactcttgggccttcgtccatatgtgaaaaggtatatgatgtaccaacaagggtgttttgcaggtggcacggtgcttcgtt 5310626  T
301 tggctaaagatttggcggagaacaacaaaggtgctcgtgtgttggttgtttgttctgaagtcactgcagttacatttcgcggccctagtgatactcactt 400  Q
    |||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || || |||||||| ||||| ||||||||||||||    
5310627 tggccaaagatttggctgagaacaacaaaggtgctcgtgtgttggttgtttgttctgaagtcaccgctgtcacatttcgtggccccagtgatactcactt 5310726  T
401 ggacagccttgttggacaagcactatttggagatggagctgctgcactaattgttggttcagatccagtaccagaaattgagaaaccaatatttgagatg 500  Q
    ||||||||||||||| |||||| | |||||||||||||||||||| || ||||||||||| || ||||||||||||||||||||||| ||||||||||||    
5310727 ggacagccttgttgggcaagcattgtttggagatggagctgctgctcttattgttggttctgacccagtaccagaaattgagaaacctatatttgagatg 5310826  T
501 gtttggactgcacaaacaattg 522  Q
    ||||||||||||||||||||||    
5310827 gtttggactgcacaaacaattg 5310848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 374; E-Value: 0
Query Start/End: Original strand, 9 - 522
Target Start/End: Complemental strand, 5289881 - 5289368
Alignment:
9 attttgaaagagaatcctagtgtttgtgagtacatggcaccttcattggatgctaggcaagacatggtgggggtagaggtacctagattagggaaggagg 108  Q
    ||||||||||| ||||| ||||||||||| |||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |||| |||||||    
5289881 attttgaaagaaaatccaagtgtttgtgaatacatggccccttcattggatgctaggcaagacatggtggtggtagaggtacctagactaggaaaggagg 5289782  T
109 ctgcagcgaaggctataaaagaatggggtcaaccaaagtcaaagattactcacttaatcgtttgcaccacgagtggtgctgacatgcctgaaactgatta 208  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||  |||||||||| | | |||||    
5289781 ctgcagtgaaggctataaaagaatggggtcaaccaaagtcaaagattactcacttaatcgtttgcaccacaagtggtgtagacatgcctggagccgatta 5289682  T
209 ccaactcacaaaactcttaggtcttcgtccatatgtgaaaaggtatatgatgtaccaacaaggttgctttgccggaggcacggtgcttcgtttggctaaa 308  Q
     ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| || ||||| || |||||||||||||||||||| |||    
5289681 tcaactcacaaaactcttgggtcttcgtccatatgtgaaaaggtatatgatgtaccaacaagggtgttttgcaggtggcacggtgcttcgtttggccaaa 5289582  T
309 gatttggcggagaacaacaaaggtgctcgtgtgttggttgtttgttctgaagtcactgcagttacatttcgcggccctagtgatactcacttggacagcc 408  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || || ||||| || ||||| ||||||||||||||||||||||    
5289581 gatttggctgagaacaacaaaggtgctcgtgtgttggttgtttgttctgaagtcaccgctgtcacattccgtggccccagtgatactcacttggacagcc 5289482  T
409 ttgttggacaagcactatttggagatggagctgctgcactaattgttggttcagatccagtaccagaaattgagaaaccaatatttgagatggtttggac 508  Q
    ||||||| |||||||| |||||||||||||||||||| || ||||||||||| || ||||||||||||||||||||||| ||||||||||||||||||||    
5289481 ttgttgggcaagcactgtttggagatggagctgctgctcttattgttggttctgacccagtaccagaaattgagaaacctatatttgagatggtttggac 5289382  T
509 tgcacaaacaattg 522  Q
    ||||||||||||||    
5289381 tgcacaaacaattg 5289368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 370; E-Value: 0
Query Start/End: Original strand, 9 - 522
Target Start/End: Original strand, 5315049 - 5315562
Alignment:
9 attttgaaagagaatcctagtgtttgtgagtacatggcaccttcattggatgctaggcaagacatggtgggggtagaggtacctagattagggaaggagg 108  Q
    ||||||||||| ||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||    
5315049 attttgaaagaaaatcctagtgtttgtgaatacatggccccttcattggatgctaggcaagacatggtggtggtagaggtacctagactagggaaggagg 5315148  T
109 ctgcagcgaaggctataaaagaatggggtcaaccaaagtcaaagattactcacttaatcgtttgcaccacgagtggtgctgacatgcctgaaactgatta 208  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| | | |||||    
5315149 ctgcagtgaaggctataaaagaatggggtcaaccaaagtcaaagattactcacttaatcgtttgcaccacaagtggtgttgacatgcctggagcagatta 5315248  T
209 ccaactcacaaaactcttaggtcttcgtccatatgtgaaaaggtatatgatgtaccaacaaggttgctttgccggaggcacggtgcttcgtttggctaaa 308  Q
     |||||||| ||||| ||||||||||| |||||||||||||| || ||||||||||||||||| |||||||| || ||||||||||| ||||||||||||    
5315249 tcaactcaccaaactattaggtcttcgcccatatgtgaaaagatacatgatgtaccaacaagggtgctttgcaggtggcacggtgctccgtttggctaaa 5315348  T
309 gatttggcggagaacaacaaaggtgctcgtgtgttggttgtttgttctgaagtcactgcagttacatttcgcggccctagtgatactcacttggacagcc 408  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || || |||||||| || ||||||||||||||||| |||||||    
5315349 gatttggctgagaacaacaaaggtgctcgtgtgttggttgtttgttctgaagtcaccgctgtcacatttcgtggtcctagtgatactcacttagacagcc 5315448  T
409 ttgttggacaagcactatttggagatggagctgctgcactaattgttggttcagatccagtaccagaaattgagaaaccaatatttgagatggtttggac 508  Q
    ||||||||||||||||||||||||||||||| ||||| || |||||||| || || |||||||||||||| |||||||| ||||||||||||||||||||    
5315449 ttgttggacaagcactatttggagatggagcggctgctcttattgttggctctgacccagtaccagaaatagagaaacctatatttgagatggtttggac 5315548  T
509 tgcacaaacaattg 522  Q
    ||||||||||||||    
5315549 tgcacaaacaattg 5315562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 354; E-Value: 0
Query Start/End: Original strand, 9 - 522
Target Start/End: Original strand, 5302434 - 5302947
Alignment:
9 attttgaaagagaatcctagtgtttgtgagtacatggcaccttcattggatgctaggcaagacatggtgggggtagaggtacctagattagggaaggagg 108  Q
    ||||||||||| ||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |||| |||||||    
5302434 attttgaaagaaaatcctagtgtttgtgaatacatggccccttcattggatgctaggcaagacatggtggtggtagaggtacctagactaggaaaggagg 5302533  T
109 ctgcagcgaaggctataaaagaatggggtcaaccaaagtcaaagattactcacttaatcgtttgcaccacgagtggtgctgacatgcctgaaactgatta 208  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||  |||||||| ||| |||||||    
5302534 ctgcagtgaaggctataaaagaatggggtcaaccaaagtcaaagattactcacttaatcgtttgcaccacaagtggtgtagacatgcccgaagctgatta 5302633  T
209 ccaactcacaaaactcttaggtcttcgtccatatgtgaaaaggtatatgatgtaccaacaaggttgctttgccggaggcacggtgcttcgtttggctaaa 308  Q
     |||||||| |||||||| |||||||| ||||||||||||||||| ||||||||||||||||| || ||||| || |||||||||||||||||||| |||    
5302634 tcaactcaccaaactcttgggtcttcgcccatatgtgaaaaggtacatgatgtaccaacaagggtgttttgcaggtggcacggtgcttcgtttggccaaa 5302733  T
309 gatttggcggagaacaacaaaggtgctcgtgtgttggttgtttgttctgaagtcactgcagttacatttcgcggccctagtgatactcacttggacagcc 408  Q
    ||| | || |||||||||||||||||||||||||||||||| ||||| || ||||| || || |||||||| |||||||||||||||||||||||||| |    
5302734 gatctagctgagaacaacaaaggtgctcgtgtgttggttgtatgttcagaggtcaccgctgtcacatttcgtggccctagtgatactcacttggacagtc 5302833  T
409 ttgttggacaagcactatttggagatggagctgctgcactaattgttggttcagatccagtaccagaaattgagaaaccaatatttgagatggtttggac 508  Q
    ||||||||||||||||||||||||||||||||||||| || |||||||| || || || |||||||||||||||||||| ||||||||||||||||||||    
5302834 ttgttggacaagcactatttggagatggagctgctgctcttattgttggctctgaccccgtaccagaaattgagaaacctatatttgagatggtttggac 5302933  T
509 tgcacaaacaattg 522  Q
    ||||||||||||||    
5302934 tgcacaaacaattg 5302947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 9 - 522
Target Start/End: Original strand, 5284246 - 5284759
Alignment:
9 attttgaaagagaatcctagtgtttgtgagtacatggcaccttcattggatgctaggcaagacatggtgggggtagaggtacctagattagggaaggagg 108  Q
    ||||||||| | ||||||||||||||||| |||||||| |||||||||||||| |||||||||||||||| |||||||||||||||| |||| |||||||    
5284246 attttgaaaaaaaatcctagtgtttgtgaatacatggccccttcattggatgcaaggcaagacatggtggtggtagaggtacctagactaggaaaggagg 5284345  T
109 ctgcagcgaaggctataaaagaatggggtcaaccaaagtcaaagattactcacttaatcgtttgcaccacgagtggtgctgacatgcctgaaactgatta 208  Q
    |||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||  |||||||||| | | |||||    
5284346 ctgcagtgaaggctataaaagaatggggccaaccaaagtcaaagattactcacttaatcgtttgcaccacaagtggtgtagacatgcctggagccgatta 5284445  T
209 ccaactcacaaaactcttaggtcttcgtccatatgtgaaaaggtatatgatgtaccaacaaggttgctttgccggaggcacggtgcttcgtttggctaaa 308  Q
     |||||||| |||||||| |||||||| ||||||||||||||||| ||||||||||||||||| || ||||| || || ||||| ||||||||||| |||    
5284446 tcaactcaccaaactcttgggtcttcgcccatatgtgaaaaggtacatgatgtaccaacaagggtgttttgcaggtggtacggtacttcgtttggccaaa 5284545  T
309 gatttggcggagaacaacaaaggtgctcgtgtgttggttgtttgttctgaagtcactgcagttacatttcgcggccctagtgatactcacttggacagcc 408  Q
    ||||| || ||||||||||||||||||||||||||||||||||||||||||||||| || || |||||||| |||||||| ||||||||||| ||||| |    
5284546 gatttagctgagaacaacaaaggtgctcgtgtgttggttgtttgttctgaagtcaccgctgtcacatttcgtggccctagcgatactcacttagacagtc 5284645  T
409 ttgttggacaagcactatttggagatggagctgctgcactaattgttggttcagatccagtaccagaaattgagaaaccaatatttgagatggtttggac 508  Q
    ||||||||||||||||||||||||||||||||||||| || |||||||| || || ||| ||||||||||||||| ||| ||||||||||||||||||||    
5284646 ttgttggacaagcactatttggagatggagctgctgctcttattgttggctctgacccaataccagaaattgagagacctatatttgagatggtttggac 5284745  T
509 tgcacaaacaattg 522  Q
    ||||||||||||||    
5284746 tgcacaaacaattg 5284759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 518 - 620
Target Start/End: Complemental strand, 5290183 - 5290081
Alignment:
518 aattgtgttgaacaaagcacatatcctgatttctactttaaaatcacaaatagtgaacacaagactgaactcaaagagaaattccaacgcatgtgtaagt 617  Q
    |||||||||||||||||||| ||||||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||| || |||||||||||||    
5290183 aattgtgttgaacaaagcacttatcctgatttttactttaaaattacaaatagtgaacacaaaactgaactcaaagagaaatttcagcgcatgtgtaagt 5290084  T
618 att 620  Q
    |||    
5290083 att 5290081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 518 - 620
Target Start/End: Original strand, 5302132 - 5302234
Alignment:
518 aattgtgttgaacaaagcacatatcctgatttctactttaaaatcacaaatagtgaacacaagactgaactcaaagagaaattccaacgcatgtgtaagt 617  Q
    |||||||||||||||||||| ||||||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||| || |||||||||||||    
5302132 aattgtgttgaacaaagcacttatcctgatttttactttaaaattacaaatagtgaacacaaaactgaactcaaagagaaatttcagcgcatgtgtaagt 5302231  T
618 att 620  Q
    |||    
5302232 att 5302234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 518 - 620
Target Start/End: Original strand, 5309769 - 5309871
Alignment:
518 aattgtgttgaacaaagcacatatcctgatttctactttaaaatcacaaatagtgaacacaagactgaactcaaagagaaattccaacgcatgtgtaagt 617  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| || |||||||| || |||||||||||||    
5309769 aattgtgttgaacaaagcacatatcctgatttttactttaaaatcacaaatagtgaacacaaaactgaacttaaggagaaatttcagcgcatgtgtaagt 5309868  T
618 att 620  Q
    |||    
5309869 att 5309871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 518 - 620
Target Start/End: Original strand, 5283944 - 5284046
Alignment:
518 aattgtgttgaacaaagcacatatcctgatttctactttaaaatcacaaatagtgaacacaagactgaactcaaagagaaattccaacgcatgtgtaagt 617  Q
    |||||||||||||||||||| ||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||||||||| || |||||||||||||    
5283944 aattgtgttgaacaaagcacgtatcctgatttttactttaaaatcacaaacagtgaacacaaaactgaacttaaagagaaatttcagcgcatgtgtaagt 5284043  T
618 att 620  Q
    |||    
5284044 att 5284046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 518 - 620
Target Start/End: Original strand, 5314586 - 5314688
Alignment:
518 aattgtgttgaacaaagcacatatcctgatttctactttaaaatcacaaatagtgaacacaagactgaactcaaagagaaattccaacgcatgtgtaagt 617  Q
    |||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||   |||||||||||||||||| || |||||||||||||    
5314586 aattgtgttgaacaaagcacatatcctgatttttactttaaaattacaaatagtgaacacaaagttgaactcaaagagaaatttcagcgcatgtgtaagt 5314685  T
618 att 620  Q
    |||    
5314686 att 5314688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 702 - 774
Target Start/End: Complemental strand, 46707251 - 46707179
Alignment:
702 aactaatatcatcttttcataattcccttcaggtgataaatctatgatcaagaggagatatatgtacctaaca 774  Q
    ||||||||||||| | |||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||    
46707251 aactaatatcatcctatcataattaccttcaggtgataaatctatgatcaagaggagatacatgtacctaaca 46707179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 728 - 777
Target Start/End: Original strand, 5310282 - 5310331
Alignment:
728 cttcaggtgataaatctatgatcaagaggagatatatgtacctaacagag 777  Q
    |||||||||||||||||||||||||||||||||| ||||| |||||||||    
5310282 cttcaggtgataaatctatgatcaagaggagatacatgtatctaacagag 5310331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 728 - 776
Target Start/End: Original strand, 5284193 - 5284241
Alignment:
728 cttcaggtgataaatctatgatcaagaggagatatatgtacctaacaga 776  Q
    |||||||||||||||||||||||||||||||||| ||||| ||||||||    
5284193 cttcaggtgataaatctatgatcaagaggagatacatgtatctaacaga 5284241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 728 - 776
Target Start/End: Original strand, 5314996 - 5315044
Alignment:
728 cttcaggtgataaatctatgatcaagaggagatatatgtacctaacaga 776  Q
    |||||||||||||||||||||||||||||||||| ||||| ||||||||    
5314996 cttcaggtgataaatctatgatcaagaggagatacatgtatctaacaga 5315044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 728 - 776
Target Start/End: Complemental strand, 5289934 - 5289886
Alignment:
728 cttcaggtgataaatctatgatcaagaggagatatatgtacctaacaga 776  Q
    |||||||||||||||| ||||||||||||||||| ||||| ||||||||    
5289934 cttcaggtgataaatccatgatcaagaggagatacatgtatctaacaga 5289886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 728 - 776
Target Start/End: Original strand, 5302381 - 5302429
Alignment:
728 cttcaggtgataaatctatgatcaagaggagatatatgtacctaacaga 776  Q
    |||||||||||||||| ||||||||||||||||| ||||| ||||||||    
5302381 cttcaggtgataaatccatgatcaagaggagatacatgtatctaacaga 5302429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 364; Significance: 0; HSPs: 16)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 364; E-Value: 0
Query Start/End: Original strand, 1 - 520
Target Start/End: Original strand, 1504907 - 1505426
Alignment:
1 cagaggagattttgaaagagaatcctagtgtttgtgagtacatggcaccttcattggatgctaggcaagacatggtgggggtagaggtacctagattagg 100  Q
    ||||||||||||| ||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||    
1504907 cagaggagattttaaaagagaatcccagtgtttgtgaatacatggcaccttcattggatgctaggcaagacatggtggtggtagaggtacctagactagg 1505006  T
101 gaaggaggctgcagcgaaggctataaaagaatggggtcaaccaaagtcaaagattactcacttaatcgtttgcaccacgagtggtgctgacatgcctgaa 200  Q
     ||||||||||| |  || |||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |||||||  |||||||||| |    
1505007 aaaggaggctgccgtaaaagctataaaagaatggggtcagccaaagtcaaagattactcacttaattgtttgcaccacaagtggtgtagacatgcctgga 1505106  T
201 actgattaccaactcacaaaactcttaggtcttcgtccatatgtgaaaaggtatatgatgtaccaacaaggttgctttgccggaggcacggtgcttcgtt 300  Q
     |||||||||||||||| ||||||||||||||||| ||||||||||| ||||| ||||||||||| ||||| || ||||| || || |||||||||||||    
1505107 gctgattaccaactcaccaaactcttaggtcttcgcccatatgtgaagaggtacatgatgtaccagcaaggatgttttgcaggtgggacggtgcttcgtt 1505206  T
301 tggctaaagatttggcggagaacaacaaaggtgctcgtgtgttggttgtttgttctgaagtcactgcagttacatttcgcggccctagtgatactcactt 400  Q
    |||| || || ||||| ||||||||||||||||| |||||||||||||| ||||| |||||||||||||| |||||||||||||||||||||||||||||    
1505207 tggccaaggacttggctgagaacaacaaaggtgcccgtgtgttggttgtctgttccgaagtcactgcagtcacatttcgcggccctagtgatactcactt 1505306  T
401 ggacagccttgttggacaagcactatttggagatggagctgctgcactaattgttggttcagatccagtaccagaaattgagaaaccaatatttgagatg 500  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| |||    
1505307 ggacagccttgttggacaagctctatttggagatggagctgctgcactaattgttggttcagatccaataccagaaattgagaaacctatatttgaaatg 1505406  T
501 gtttggactgcacaaacaat 520  Q
    ||||||||||||||||||||    
1505407 gtttggactgcacaaacaat 1505426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 346; E-Value: 0
Query Start/End: Original strand, 1 - 522
Target Start/End: Original strand, 1492098 - 1492619
Alignment:
1 cagaggagattttgaaagagaatcctagtgtttgtgagtacatggcaccttcattggatgctaggcaagacatggtgggggtagaggtacctagattagg 100  Q
    ||||||||||||| ||||||||||||| ||||||||| |||||||||||||||||||||||||| ||||||||||||| |||||| ||||||||| ||||    
1492098 cagaggagattttaaaagagaatcctaatgtttgtgaatacatggcaccttcattggatgctagacaagacatggtggtggtagaagtacctagactagg 1492197  T
101 gaaggaggctgcagcgaaggctataaaagaatggggtcaaccaaagtcaaagattactcacttaatcgtttgcaccacgagtggtgctgacatgcctgaa 200  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||  ||||||||||      
1492198 gaaggaggctgcagtgaaggctataaaagaatggggtcaaccaaagtcaaagattactcacttaatcgtttgcaccacaagcggtgtagacatgcctggg 1492297  T
201 actgattaccaactcacaaaactcttaggtcttcgtccatatgtgaaaaggtatatgatgtaccaacaaggttgctttgccggaggcacggtgcttcgtt 300  Q
     | ||||| |||||||| |||||||||||||||||||||||||| ||||| || ||||||||||| |||||||| ||||| || |||||||| |||||||    
1492298 gccgattatcaactcactaaactcttaggtcttcgtccatatgtaaaaagatacatgatgtaccagcaaggttgttttgcaggtggcacggtacttcgtt 1492397  T
301 tggctaaagatttggcggagaacaacaaaggtgctcgtgtgttggttgtttgttctgaagtcactgcagttacatttcgcggccctagtgatactcactt 400  Q
    ||||||| |||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| || || |||||||| |||||    
1492398 tggctaaggatttggctgagaacaacaaaggtgctcgtgtgttagttgtttgttctgaagtcactgcagtcacatttcgtggtcccagtgatacacactt 1492497  T
401 ggacagccttgttggacaagcactatttggagatggagctgctgcactaattgttggttcagatccagtaccagaaattgagaaaccaatatttgagatg 500  Q
    |||||| |||||||||||||||||||||||||||||||| |||||||| |||||||| || ||||| |||||||||||||| ||||| ||||||||||||    
1492498 ggacagtcttgttggacaagcactatttggagatggagcagctgcacttattgttgggtctgatccggtaccagaaattgaaaaacctatatttgagatg 1492597  T
501 gtttggactgcacaaacaattg 522  Q
     ||||||| |||||||||||||    
1492598 atttggacagcacaaacaattg 1492619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 6 - 522
Target Start/End: Original strand, 1482128 - 1482644
Alignment:
6 gagattttgaaagagaatcctagtgtttgtgagtacatggcaccttcattggatgctaggcaagacatggtgggggtagaggtacctagattagggaagg 105  Q
    |||||||||||||| ||||||||||| || || |||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| |||| ||||    
1482128 gagattttgaaagaaaatcctagtgtatgcgaatacatggcaccttcattggatgctaggcaagacatggtggtggtagaggtgcctagactaggaaagg 1482227  T
106 aggctgcagcgaaggctataaaagaatggggtcaaccaaagtcaaagattactcacttaatcgtttgcaccacgagtggtgctgacatgcctgaaactga 205  Q
    ||||||||| ||||||||||||||||||||| |||||||| ||||||||||| ||||||||  |||| ||||| |||||||  ||||||||||   | ||    
1482228 aggctgcagtgaaggctataaaagaatggggccaaccaaaatcaaagattacacacttaatattttgtaccacaagtggtgtagacatgcctggtgccga 1482327  T
206 ttaccaactcacaaaactcttaggtcttcgtccatatgtgaaaaggtatatgatgtaccaacaaggttgctttgccggaggcacggtgcttcgtttggct 305  Q
    |||||||||||||||||||||||||||||||||||||||||| || || ||||||||||||||||| |||||||| || || |||||||||||||||||     
1482328 ttaccaactcacaaaactcttaggtcttcgtccatatgtgaagagatacatgatgtaccaacaaggatgctttgcaggtgggacggtgcttcgtttggcc 1482427  T
306 aaagatttggcggagaacaacaaaggtgctcgtgtgttggttgtttgttctgaagtcactgcagttacatttcgcggccctagtgatactcacttggaca 405  Q
    || || ||||| ||||| || ||||||||||||||||||||||||||||||||||| |||||||| ||||| || || |||||||||||||| |||||||    
1482428 aaggacttggctgagaataataaaggtgctcgtgtgttggttgtttgttctgaagttactgcagtgacattccgtggtcctagtgatactcatttggaca 1482527  T
406 gccttgttggacaagcactatttggagatggagctgctgcactaattgttggttcagatccagtaccagaaattgagaaaccaatatttgagatggtttg 505  Q
    | ||||||||||||||||| ||||||||||||||||||||||| ||||||||||| || ||| ||||||||||||||||||| |||||||||||||||||    
1482528 gtcttgttggacaagcactctttggagatggagctgctgcactcattgttggttctgacccaataccagaaattgagaaacctatatttgagatggtttg 1482627  T
506 gactgcacaaacaattg 522  Q
    |||||||||||||||||    
1482628 gactgcacaaacaattg 1482644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 9 - 522
Target Start/End: Original strand, 1477937 - 1478450
Alignment:
9 attttgaaagagaatcctagtgtttgtgagtacatggcaccttcattggatgctaggcaagacatggtgggggtagaggtacctagattagggaaggagg 108  Q
    ||||||||||| ||||| ||||| ||||| ||||||||||| ||||||||||||||||| |||||||||| |||||| ||||||||| |||| |||||||    
1477937 attttgaaagaaaatccaagtgtatgtgaatacatggcaccgtcattggatgctaggcaggacatggtggtggtagaagtacctagactaggaaaggagg 1478036  T
109 ctgcagcgaaggctataaaagaatggggtcaaccaaagtcaaagattactcacttaatcgtttgcaccacgagtggtgctgacatgcctgaaactgatta 208  Q
    |||||| ||| ||||||||||||||||| |||||||| ||||||||||| ||||| ||| |||||||||| |||||||  ||||||||||   |||||||    
1478037 ctgcagtgaaagctataaaagaatggggccaaccaaaatcaaagattacacacttgatcttttgcaccacaagtggtgtagacatgcctggcgctgatta 1478136  T
209 ccaactcacaaaactcttaggtcttcgtccatatgtgaaaaggtatatgatgtaccaacaaggttgctttgccggaggcacggtgcttcgtttggctaaa 308  Q
    ||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| || ||||| || || ||||||||||||||||| ||     
1478137 ccaactcaccaaactcttaggtcttcgtccatatgtgaagaggtatatgatgtaccaacaaggatgttttgcaggtgggacggtgcttcgtttggccaag 1478236  T
309 gatttggcggagaacaacaaaggtgctcgtgtgttggttgtttgttctgaagtcactgcagttacatttcgcggccctagtgatactcacttggacagcc 408  Q
    || ||||| |||||||| ||||||||||||||||||||||||||||||||||| |||||||| ||||| || || |||||||||||||| |||||||| |    
1478237 gacttggctgagaacaataaaggtgctcgtgtgttggttgtttgttctgaagttactgcagtgacattccgtggtcctagtgatactcatttggacagtc 1478336  T
409 ttgttggacaagcactatttggagatggagctgctgcactaattgttggttcagatccagtaccagaaattgagaaaccaatatttgagatggtttggac 508  Q
    |||||||||||||||||||||||||||| ||||||||||| ||||||||||| || ||| ||||||||||||||||||| ||||||||||||||||||||    
1478337 ttgttggacaagcactatttggagatggtgctgctgcactcattgttggttctgacccaataccagaaattgagaaacctatatttgagatggtttggac 1478436  T
509 tgcacaaacaattg 522  Q
    ||||||||||||||    
1478437 tgcacaaacaattg 1478450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 250; E-Value: 1e-138
Query Start/End: Original strand, 1 - 522
Target Start/End: Original strand, 1509054 - 1509575
Alignment:
1 cagaggagattttgaaagagaatcctagtgtttgtgagtacatggcaccttcattggatgctaggcaagacatggtgggggtagaggtacctagattagg 100  Q
    |||| |||||||||||||||||||| | ||||||||  || | |||||| ||||||||||||||||||||||||||||  ||| ||||||||||  ||||    
1509054 cagaagagattttgaaagagaatcccaatgtttgtgcttatacggcaccatcattggatgctaggcaagacatggtggttgtaaaggtacctaggctagg 1509153  T
101 gaaggaggctgcagcgaaggctataaaagaatggggtcaaccaaagtcaaagattactcacttaatcgtttgcaccacgagtggtgctgacatgcctgaa 200  Q
     || |||| ||||| ||||||||||||||||||||| || ||||| ||||||||||| || |||||| |||||||||| ||||||| ||| ||| ||| |    
1509154 aaaagaggttgcagtgaaggctataaaagaatggggccagccaaaatcaaagattacacatttaatcttttgcaccacaagtggtgttgatatgtctgga 1509253  T
201 actgattaccaactcacaaaactcttaggtcttcgtccatatgtgaaaaggtatatgatgtaccaacaaggttgctttgccggaggcacggtgcttcgtt 300  Q
     || |||| ||||| || ||||| ||||||||||  |||||||| |||||||| ||||||||||||||| | || ||||| || ||||| ||||||| ||    
1509254 gctcattatcaacttaccaaacttttaggtcttcacccatatgtaaaaaggtacatgatgtaccaacaaaggtgttttgcaggtggcactgtgcttcatt 1509353  T
301 tggctaaagatttggcggagaacaacaaaggtgctcgtgtgttggttgtttgttctgaagtcactgcagttacatttcgcggccctagtgatactcactt 400  Q
    |||| || |||||||| || || ||| ||| ||||||||||||||||||||||||| |||||| |||||| |||||| | |||||| |||||||||| ||    
1509354 tggcaaaggatttggctgaaaataaccaagatgctcgtgtgttggttgtttgttctaaagtcattgcagtcacattttgtggccctggtgatactcattt 1509453  T
401 ggacagccttgttggacaagcactatttggagatggagctgctgcactaattgttggttcagatccagtaccagaaattgagaaaccaatatttgagatg 500  Q
    |||||| ||||||||||||||| ||||||||||||||||||||||||| ||||||||| | || || |||||||||||||||||| | ||||||||||||    
1509454 ggacagtcttgttggacaagcattatttggagatggagctgctgcactcattgttggtactgaccctgtaccagaaattgagaaatctatatttgagatg 1509553  T
501 gtttggactgcacaaacaattg 522  Q
    ||||||||||||||||||||||    
1509554 gtttggactgcacaaacaattg 1509575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 46 - 522
Target Start/End: Original strand, 1499215 - 1499691
Alignment:
46 caccttcattggatgctaggcaagacatggtgggggtagaggtacctagattagggaaggaggctgcagcgaaggctataaaagaatggggtcaaccaaa 145  Q
    ||||||| ||||||||||||||||||||| ||| ||||||| |||||||| |||||||||||||||||| |||||||||  |||||||||||||||| ||    
1499215 caccttctttggatgctaggcaagacatgatggcggtagagatacctagactagggaaggaggctgcagtgaaggctatcgaagaatggggtcaaccgaa 1499314  T
146 gtcaaagattactcacttaatcgtttgcaccacgagtggtgctgacatgcctgaaactgattaccaactcacaaaactcttaggtcttcgtccatatgtg 245  Q
    |||||| ||||| || |||||  ||||||||   |||||||  ||||||||||   | ||||||||||| ||||||||||||||||||   |||||||||    
1499315 gtcaaatattacacatttaattttttgcacctatagtggtgtagacatgcctggtgcggattaccaactaacaaaactcttaggtcttaacccatatgtg 1499414  T
246 aaaaggtatatgatgtaccaacaaggttgctttgccggaggcacggtgcttcgtttggctaaagatttggcggagaacaacaaaggtgctcgtgtgttgg 345  Q
    |||||||| ||||||||||||| ||| || | ||| || || || || ||||||||||| || || || || ||||| ||||||||||||||||||||||    
1499415 aaaaggtacatgatgtaccaactagggtgttatgcaggtggaacagtacttcgtttggcgaaggacttagctgagaataacaaaggtgctcgtgtgttgg 1499514  T
346 ttgtttgttctgaagtcactgcagttacatttcgcggccctagtgatactcacttggacagccttgttggacaagcactatttggagatggagctgctgc 445  Q
    |||||||||||||| |||||||| |  ||||| | || |||||| |||||||| |  |||  ||||||||||||||| ||||||||||||||||||| ||    
1499515 ttgtttgttctgaaatcactgcaatctcattttgtggacctagtaatactcacctacacaaacttgttggacaagcaatatttggagatggagctgcggc 1499614  T
446 actaattgttggttcagatccagtaccagaaattgagaaaccaatatttgagatggtttggactgcacaaacaattg 522  Q
    | | |||||||| || || | |||||| ||||||||||||||  |||||||| | ||||||||||||||||||||||    
1499615 agtcattgttggctctgacctagtacctgaaattgagaaacctttatttgagttagtttggactgcacaaacaattg 1499691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 157; E-Value: 5e-83
Query Start/End: Original strand, 9 - 520
Target Start/End: Original strand, 1486608 - 1487119
Alignment:
9 attttgaaagagaatcctagtgtttgtgagtacatggcaccttcattggatgctaggcaagacatggtgggggtagaggtacctagattagggaaggagg 108  Q
    ||||||||||||||||||| | ||||    || ||| ||||||| ||||||||||||||||||||||||| |  ||| || |||||  |||| || ||||    
1486608 attttgaaagagaatcctaatttttgcacttatatgacaccttctttggatgctaggcaagacatggtggtgcgagacgtgcctaggctaggaaatgagg 1486707  T
109 ctgcagcgaaggctataaaagaatggggtcaaccaaagtcaaagattactcacttaatcgtttgcaccacgagtggtgctgacatgcctgaaactgatta 208  Q
    |||||| ||| ||||||||||||| ||| |||||||||||||||||||| ||||||||  ||||||||| |||||||   | ||||||||   | |||||    
1486708 ctgcagtgaaagctataaaagaatagggccaaccaaagtcaaagattacacacttaatattttgcaccatgagtggtataggcatgcctggtgccgatta 1486807  T
209 ccaactcacaaaactcttaggtcttcgtccatatgtgaaaaggtatatgatgtaccaacaaggttgctttgccggaggcacggtgcttcgtttggctaaa 308  Q
    ||||||||||||||||||||||||| | ||  |||||||| |||||||||| ||||||||||| |||||||| || ||||| || || |||| ||| ||     
1486808 ccaactcacaaaactcttaggtctttgcccggatgtgaaacggtatatgatataccaacaaggatgctttgcagggggcactgttctacgttaggccaag 1486907  T
309 gatttggcggagaacaacaaaggtgctcgtgtgttggttgtttgttctgaagtcactgcagttac-atttcgcggccctagtgatactcacttggacagc 407  Q
    || ||||| |||||||| |||| ||||| |||||||||  | ||||||||||||||| || | || |||| | ||||||| ||| ||| || ||  || |    
1486908 gacttggctgagaacaataaagatgctcttgtgttggtaatatgttctgaagtcactaca-tcactattttgtggccctaatgaaactgacatgagcaac 1487006  T
408 cttgttggacaagcactatttggagatggagctgctgcactaattgttggttcagatccagtaccagaaattgagaaaccaatatttgagatggtttgga 507  Q
    ||||||||||||||| ||||||| |||||||||| || | | |||||||| || |||||  || || |||||||||||||  | |||||| | |||||||    
1487007 cttgttggacaagcattatttggtgatggagctgttgtagtcattgttggctccgatccgatatcaaaaattgagaaacctctctttgagcttgtttgga 1487106  T
508 ctgcacaaacaat 520  Q
    |||||||||||||    
1487107 ctgcacaaacaat 1487119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 88; E-Value: 7e-42
Query Start/End: Original strand, 518 - 625
Target Start/End: Original strand, 1504435 - 1504542
Alignment:
518 aattgtgttgaacaaagcacatatcctgatttctactttaaaatcacaaatagtgaacacaagactgaactcaaagagaaattccaacgcatgtgtaagt 617  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| |||||||||||||||||||| ||||||||||||||||    
1504435 aattgtgttgaacaaagcacatatcctgatttctactttagaatcacaaacagtgaacacaaaactgaactcaaagagaaatttcaacgcatgtgtaagt 1504534  T
618 attttttc 625  Q
     |||||||    
1504535 gttttttc 1504542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 521 - 619
Target Start/End: Original strand, 1491674 - 1491772
Alignment:
521 tgtgttgaacaaagcacatatcctgatttctactttaaaatcacaaatagtgaacacaagactgaactcaaagagaaattccaacgcatgtgtaagtat 619  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| ||||| |||||||| ||||| ||||||||||||||||||    
1491674 tgtgttgaacaaagcacatatcctgatttttactttaaaatcacaaatagcgaacacaaaactgagctcaaagaaaaatttcaacgcatgtgtaagtat 1491772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 66; E-Value: 9e-29
Query Start/End: Original strand, 672 - 777
Target Start/End: Original strand, 1504807 - 1504911
Alignment:
672 cattggtttcttatcacccaagttttgttgaactaatatcatcttttcataattcccttcaggtgataaatctatgatcaagaggagatatatgtaccta 771  Q
    ||||| |||| |||||||||| ||| |||||||||||||||||| ||||||||| ||||||||||||||||||||||| ||||| ||||| |||||||||    
1504807 cattgatttcgtatcacccaaattt-gttgaactaatatcatctcttcataattaccttcaggtgataaatctatgattaagagaagatacatgtaccta 1504905  T
772 acagag 777  Q
    ||||||    
1504906 acagag 1504911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 521 - 620
Target Start/End: Original strand, 1477673 - 1477772
Alignment:
521 tgtgttgaacaaagcacatatcctgatttctactttaaaatcacaaatagtgaacacaagactgaactcaaagagaaattccaacgcatgtgtaagtatt 620  Q
    ||||||||||||||||||||||||||||| ||||| ||||||||||| ||||| |||||   |||||| ||||| ||||| |||||||||||||||||||    
1477673 tgtgttgaacaaagcacatatcctgatttttacttcaaaatcacaaacagtgagcacaaagttgaacttaaagaaaaatttcaacgcatgtgtaagtatt 1477772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 521 - 624
Target Start/End: Original strand, 1481784 - 1481887
Alignment:
521 tgtgttgaacaaagcacatatcctgatttctactttaaaatcacaaatagtgaacacaagactgaactcaaagagaaattccaacgcatgtgtaagtatt 620  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||| ||||| || ||    ||||||||||| ||||| ||||||||||||||||| |    
1481784 tgtgttgaacaaagcacatatcctgatttttactttaaaatcacaaacagtgagcataaagtcgaactcaaagaaaaatttcaacgcatgtgtaagtact 1481883  T
621 tttt 624  Q
    ||||    
1481884 tttt 1481887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 518 - 620
Target Start/End: Original strand, 1485517 - 1485621
Alignment:
518 aattgtgttgaacaaagcacatatcctgatttc--tactttaaaatcacaaatagtgaacacaagactgaactcaaagagaaattccaacgcatgtgtaa 615  Q
    |||||||||||||||||||||||||||||||||  ||||| | |||| ||||||| || ||||||||  |||||| ||||||||| || ||||| |||||    
1485517 aattgtgttgaacaaagcacatatcctgatttctatacttcagaatcgcaaatagcgagcacaagacgcaactcagagagaaatttcagcgcatttgtaa 1485616  T
616 gtatt 620  Q
    |||||    
1485617 gtatt 1485621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 518 - 618
Target Start/End: Original strand, 1496881 - 1496981
Alignment:
518 aattgtgttgaacaaagcacatatcctgatttctactttaaaatcacaaatagtgaacacaagactgaactcaaagagaaattccaacgcatgtgtaagt 617  Q
    |||||| ||||||||||||||||||||||| |||| || | | ||||||| | ||| |||||||||||| | ||| |||||||||| ||||| ||| |||    
1496881 aattgtattgaacaaagcacatatcctgatctctatttcagagtcacaaacaatgagcacaagactgaattaaaaaagaaattccagcgcatatgttagt 1496980  T
618 a 618  Q
    |    
1496981 a 1496981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 728 - 767
Target Start/End: Original strand, 1482078 - 1482117
Alignment:
728 cttcaggtgataaatctatgatcaagaggagatatatgta 767  Q
    |||||||||||||||||||||||||||||||||| |||||    
1482078 cttcaggtgataaatctatgatcaagaggagatacatgta 1482117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 728 - 767
Target Start/End: Original strand, 1477884 - 1477923
Alignment:
728 cttcaggtgataaatctatgatcaagaggagatatatgta 767  Q
    |||||||||||||||| ||||||||||||||||| |||||    
1477884 cttcaggtgataaatccatgatcaagaggagatacatgta 1477923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 42 - 520
Target Start/End: Complemental strand, 24163941 - 24163463
Alignment:
42 atggcaccttcattggatgctaggcaagacatggtgggggtagaggtacctagattagggaaggaggctgcagcgaaggctataaaagaatggggtcaac 141  Q
    ||||||||||| |||||| ||||||||||||||||||  ||||||| ||| ||| |||| |||||||| || | ||||||||||||||||||||| ||||    
24163941 atggcaccttctttggatactaggcaagacatggtggtagtagaggcaccaagactaggaaaggaggcagccgtgaaggctataaaagaatggggccaac 24163842  T
142 caaagtcaaagattactcacttaatcgtttgcaccacgagtggtgctgacatgcctgaaactgattaccaactcacaaaactcttaggtcttcgtccata 241  Q
    ||||||||||||| || ||||||||  ||||||| |  |||||||  || |||||||   | |||||||||||||||||||||||||||||||| ||||     
24163841 caaagtcaaagatcacacacttaatattttgcactataagtggtgtagatatgcctggtgccgattaccaactcacaaaactcttaggtcttcgcccatg 24163742  T
242 tgtgaaaaggtatatgatgtaccaacaaggttgctttgccggaggcacggtgcttcgtttggctaaagatttggcggagaacaacaaaggtgctcgtgtg 341  Q
    ||| |||||||||||||||||||||||||| || ||||| || |||||||| ||||| ||||| || || ||||| ||||||||||||||| ||||||||    
24163741 tgtaaaaaggtatatgatgtaccaacaagggtgttttgcaggtggcacggtacttcgcttggccaaggacttggctgagaacaacaaaggttctcgtgtg 24163642  T
342 ttggttgtttgttctgaagtcactgcagttacatttcgcggccctagtgatactcacttggacagccttgttggacaagcactatttggagatggagctg 441  Q
    |||||||||||||||||||| || ||| | |||||| | || || || ||||||||||| |||| ||||||||||||||| |||||||||||||||||||    
24163641 ttggttgtttgttctgaagttaccgcaatcacattttgtggaccaagcgatactcacttagacaaccttgttggacaagctctatttggagatggagctg 24163542  T
442 ctgcactaattgttggttcagatccagtaccagaaattgagaaaccaatatttgagatggtttggactgcacaaacaat 520  Q
    ||||| | |||||||| || || ||| |||  ||||||||||||||  |||||||| | |||||||| |||||||||||    
24163541 ctgcagtcattgttggctctgacccaatacaggaaattgagaaacctctatttgagttagtttggacagcacaaacaat 24163463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 56; E-Value: 8e-23
Query Start/End: Original strand, 521 - 620
Target Start/End: Complemental strand, 24165535 - 24165436
Alignment:
521 tgtgttgaacaaagcacatatcctgatttctactttaaaatcacaaatagtgaacacaagactgaactcaaagagaaattccaacgcatgtgtaagtatt 620  Q
    ||||||||||||||||||||||||||||||||||||| | ||||||| || || |||||||   |||||||||| ||||| |||||||| ||||||||||    
24165535 tgtgttgaacaaagcacatatcctgatttctactttagagtcacaaacagcgagcacaagatcaaactcaaagaaaaatttcaacgcatttgtaagtatt 24165436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 732 - 773
Target Start/End: Complemental strand, 24164023 - 24163982
Alignment:
732 aggtgataaatctatgatcaagaggagatatatgtacctaac 773  Q
    |||||||||| ||||||||||||||||||| |||||||||||    
24164023 aggtgataaaactatgatcaagaggagatacatgtacctaac 24163982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 163; Significance: 1e-86; HSPs: 5)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 163; E-Value: 1e-86
Query Start/End: Original strand, 6 - 520
Target Start/End: Complemental strand, 37863577 - 37863063
Alignment:
6 gagattttgaaagagaatcctagtgtttgtgagtacatggcaccttcattggatgctaggcaagacatggtgggggtagaggtacctagattagggaagg 105  Q
    ||||||||||| |||||||||||| | |||||||| ||||||||||| |||||||| || || || |||||||  || || ||||| |   |||| || |    
37863577 gagattttgaaggagaatcctagtttatgtgagtatatggcaccttcgttggatgcaagacaggatatggtggttgtggaagtaccaaagctaggaaaag 37863478  T
106 aggctgcagcgaaggctataaaagaatggggtcaaccaaagtcaaagattactcacttaatcgtttgcaccacgagtggtgctgacatgcctgaaactga 205  Q
    |||||||| | |||||||| || |||||||||||||| |||||||||||||||||  ||||  |||||||||| |||||||  || |||||||   ||||    
37863477 aggctgcaacaaaggctatcaaggaatggggtcaacctaagtcaaagattactcatctaattttttgcaccacaagtggtgtggatatgcctggtgctga 37863378  T
206 ttaccaactcacaaaactcttaggtcttcgtccatatgtgaaaaggtatatgatgtaccaacaaggttgctttgccggaggcacggtgcttcgtttggct 305  Q
     || || |||||||| ||||| |||||||| || ||||||||  | ||||||||||| ||||||||||| ||||| || || ||||||||||||||||||    
37863377 ctatcagctcacaaagctcttgggtcttcgcccgtatgtgaagcgttatatgatgtatcaacaaggttgttttgctggtgggacggtgcttcgtttggct 37863278  T
306 aaagatttggcggagaacaacaaaggtgctcgtgtgttggttgtttgttctgaagtcactgcagttacatttcgcggccctagtgatactcacttggaca 405  Q
    ||||||||||| || ||||||||||| |||||||| ||||| |||||||| ||  ||||||||||||| || || || ||||||||||||||  | || |    
37863277 aaagatttggctgaaaacaacaaaggcgctcgtgttttggtggtttgttcggagatcactgcagttactttccgtggacctagtgatactcatcttgata 37863178  T
406 gccttgttggacaagcactatttggagatggagctgctgcactaattgttggttcagatccagtaccagaaattgagaaaccaatatttgagatggtttg 505  Q
    | ||||| || || ||| | ||||||||||| || || ||  | |||||||||||||||||  | |||||| ||||||| ||  | |||||  |||||||    
37863177 gtcttgtggggcaggcattgtttggagatggtgcagcagctgtgattgttggttcagatccgttgccagaagttgagaagcctttgtttgaattggtttg 37863078  T
506 gactgcacaaacaat 520  Q
    |||||||||||||||    
37863077 gactgcacaaacaat 37863063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 157; E-Value: 5e-83
Query Start/End: Original strand, 13 - 517
Target Start/End: Complemental strand, 37859544 - 37859040
Alignment:
13 tgaaagagaatcctagtgtttgtgagtacatggcaccttcattggatgctaggcaagacatggtgggggtagaggtacctagattagggaaggaggctgc 112  Q
    ||||||||||||| ||||| || |||||||||||||||||||||||||| || |||||||||||||  || |||||||| ||| |||| || ||||| ||    
37859544 tgaaagagaatccaagtgtatgcgagtacatggcaccttcattggatgcaagacaagacatggtggttgtggaggtaccaagactaggaaaagaggcagc 37859445  T
113 agcgaaggctataaaagaatggggtcaaccaaagtcaaagattactcacttaatcgtttgcaccacgagtggtgctgacatgcctgaaactgattaccaa 212  Q
    | | ||||| || || |||||||||||||| ||||| |||||||| ||| | ||| |||||||||| ||||| |  |||||||| |   | || || ||     
37859444 aacaaaggccatcaaggaatggggtcaacctaagtccaagattacccacctcatcttttgcaccaccagtggcgtggacatgcccggtgccgactatcag 37859345  T
213 ctcacaaaactcttaggtcttcgtccatatgtgaaaaggtatatgatgtaccaacaaggttgctttgccggaggcacggtgcttcgtttggctaaagatt 312  Q
    || ||||| ||||| || |||||||||||||||||  | || |||||||||||||||||||| ||||| || |||||||||||||||||||||||||| |    
37859344 ctgacaaagctcttgggccttcgtccatatgtgaagcgttacatgatgtaccaacaaggttgttttgctggtggcacggtgcttcgtttggctaaagact 37859245  T
313 tggcggagaacaacaaaggtgctcgtgtgttggttgtttgttctgaagtcactgcagttacatttcgcggccctagtgatactcacttggacagccttgt 412  Q
    |||| || |||||||||||||||||||||||||| |||||||| ||  | ||||||||||| || || || || ||||| |||||  | || ||||||||    
37859244 tggctgaaaacaacaaaggtgctcgtgtgttggtagtttgttcagagataactgcagttactttccgtggacccagtgacactcatcttgatagccttgt 37859145  T
413 tggacaagcactatttggagatggagctgctgcactaattgttggttcagatccagtaccagaaattgagaaaccaatatttgagatggtttggactgca 512  Q
     || |||||| | ||||||||||| || || ||  | || || |||||||| ||| ||||| || ||||||||||  | |||||  |||| |||||||||    
37859144 ggggcaagcattgtttggagatggtgcagcagctgtgatcgtaggttcagacccattaccacaagttgagaaacccttgtttgaattggtatggactgca 37859045  T
513 caaac 517  Q
    |||||    
37859044 caaac 37859040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 117 - 344
Target Start/End: Original strand, 39030117 - 39030344
Alignment:
117 aaggctataaaagaatggggtcaaccaaagtcaaagattactcacttaatcgtttgcaccacgagtggtgctgacatgcctgaaactgattaccaactca 216  Q
    |||||||| || |||||||||||||| ||||||| | |||||||  | ||  |||||||  | |||||||  || ||||||| | |||| || || ||||    
39030117 aaggctatcaatgaatggggtcaacctaagtcaatggttactcatctcatattttgcacttcaagtggtgtcgatatgcctggagctgactatcagctca 39030216  T
217 caaaactcttaggtcttcgtccatatgtgaaaaggtatatgatgtaccaacaaggttgctttgccggaggcacggtgcttcgtttggctaaagatttggc 316  Q
    |||| |||||||| ||| |||||||||| ||  | ||||||||||||||||||||||| ||||| || |  | ||  ||||| |||||||||||||||||    
39030217 caaagctcttaggcctttgtccatatgtaaagcgttatatgatgtaccaacaaggttgttttgctggtgcgatggctcttcgcttggctaaagatttggc 39030316  T
317 ggagaacaacaaaggtgctcgtgtgttg 344  Q
     ||||||||||||||||| |||||||||    
39030317 tgagaacaacaaaggtgcccgtgtgttg 39030344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 521 - 616
Target Start/End: Complemental strand, 37863811 - 37863716
Alignment:
521 tgtgttgaacaaagcacatatcctgatttctactttaaaatcacaaatagtgaacacaagactgaactcaaagagaaattccaacgcatgtgtaag 616  Q
    |||||||| || || ||||||||||| || |||||    |||||||| ||||||||||| |||||||||| ||| |||||||| ||||||||||||    
37863811 tgtgttgatcagagtacatatcctgacttttacttccgtatcacaaacagtgaacacaaaactgaactcagagaaaaattccagcgcatgtgtaag 37863716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 560 - 616
Target Start/End: Complemental strand, 37859782 - 37859726
Alignment:
560 atcacaaatagtgaacacaagactgaactcaaagagaaattccaacgcatgtgtaag 616  Q
    |||||||| |||||||| |||||||| |||||||| ||||| || ||||||||||||    
37859782 atcacaaacagtgaacataagactgagctcaaagaaaaatttcagcgcatgtgtaag 37859726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 98; Significance: 7e-48; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 98; E-Value: 7e-48
Query Start/End: Original strand, 1 - 442
Target Start/End: Original strand, 35250741 - 35251182
Alignment:
1 cagaggagattttgaaagagaatcctagtgtttgtgagtacatggcaccttcattggatgctaggcaagacatggtgggggtagaggtacctagattagg 100  Q
    ||||||| ||| ||||||| ||||| | | | ||||  ||||||||||| ||||||||||| || ||||| |||||||  |||||||| || || |||||    
35250741 cagaggaaattctgaaagaaaatcccaatatgtgtgcttacatggcaccatcattggatgcaagacaagatatggtggtagtagaggtgccaaggttagg 35250840  T
101 gaaggaggctgcagcgaaggctataaaagaatggggtcaaccaaagtcaaagattactcacttaatcgtttgcaccacgagtggtgctgacatgcctgaa 200  Q
     || || || ||| | || || || || |||||||||||||||||||| ||||| |||||| | ||  ||||||  || |||||||  || |||||||      
35250841 aaaagaagcagcaacaaaagcgatcaaggaatggggtcaaccaaagtccaagatcactcacctcatattttgcattactagtggtgtggatatgcctggt 35250940  T
201 actgattaccaactcacaaaactcttaggtcttcgtccatatgtgaaaaggtatatgatgtaccaacaaggttgctttgccggaggcacggtgcttcgtt 300  Q
     ||||||| || ||||||||| |  |||| |||||||| |  |||||| | |||||||||||||||||||| || || || || || | ||| |||||||    
35250941 gctgattatcagctcacaaaattgctaggacttcgtccgtcggtgaaacgttatatgatgtaccaacaagggtgtttcgctggtggtatggttcttcgtt 35251040  T
301 tggctaaagatttggcggagaacaacaaaggtgctcgtgtgttggttgtttgttctgaagtcactgcagttacatttcgcggccctagtgatactcactt 400  Q
    |||||||||||||||| |||||||| ||||||||||||||  | || |||||||| ||  |||||||||| || ||||| ||||||||||| || ||  |    
35251041 tggctaaagatttggctgagaacaataaaggtgctcgtgttcttgtggtttgttcagagatcactgcagtgacttttcgtggccctagtgacacccatct 35251140  T
401 ggacagccttgttggacaagcactatttggagatggagctgc 442  Q
     || || || || ||||||||| | ||||||||||| |||||    
35251141 tgatagtctcgtgggacaagcattgtttggagatggcgctgc 35251182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175886 times since January 2019
Visitors: 1577