View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk88-19 (Length: 1245)

Name: R108-tnk88-19
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk88-19
R108-tnk88-19
[»] chr5 (26 HSPs)
chr5 (1-1182)||(37704455-37705636)
chr5 (1-364)||(37698974-37699349)
chr5 (1-304)||(37437521-37437823)
chr5 (758-960)||(37437914-37438116)
chr5 (1-248)||(37698637-37698864)
chr5 (966-1165)||(37438187-37438386)
chr5 (851-958)||(37700646-37700753)
chr5 (1179-1238)||(37704400-37704459)
chr5 (970-1160)||(37700838-37701026)
chr5 (1182-1238)||(37437469-37437525)
chr5 (1179-1238)||(37698582-37698641)
chr5 (490-632)||(34599459-34599603)
chr5 (484-632)||(2143247-2143394)
chr5 (512-735)||(13953394-13953616)
chr5 (662-739)||(1629760-1629837)
chr5 (640-756)||(1629683-1629799)
chr5 (640-756)||(29532047-29532161)
chr5 (484-587)||(26325678-26325781)
chr5 (642-683)||(2143379-2143420)
chr5 (650-735)||(30384213-30384297)
chr5 (487-535)||(38458771-38458819)
chr5 (650-737)||(37704830-37704917)
chr5 (641-704)||(41232901-41232964)
chr5 (505-565)||(29531914-29531975)
chr5 (422-463)||(37705104-37705145)
chr5 (640-736)||(38458805-38458899)
[»] chr4 (28 HSPs)
chr4 (128-364)||(16840857-16841109)
chr4 (966-1129)||(16840376-16840535)
chr4 (777-950)||(16840622-16840796)
chr4 (1053-1168)||(16840263-16840378)
chr4 (484-615)||(22519386-22519518)
chr4 (484-735)||(31095124-31095377)
chr4 (640-754)||(22519807-22519921)
chr4 (646-735)||(48194394-48194483)
chr4 (484-614)||(49291205-49291335)
chr4 (662-754)||(33617920-33618010)
chr4 (499-735)||(20141745-20141983)
chr4 (647-735)||(22889586-22889674)
chr4 (647-735)||(22941250-22941338)
chr4 (1189-1224)||(16841203-16841238)
chr4 (660-735)||(53769786-53769861)
chr4 (650-756)||(2323266-2323372)
chr4 (667-741)||(42676809-42676883)
chr4 (427-464)||(31095095-31095132)
chr4 (484-549)||(51580077-51580140)
chr4 (650-733)||(34013780-34013861)
chr4 (655-730)||(22519373-22519448)
chr4 (641-736)||(34717567-34717660)
chr4 (640-691)||(40070309-40070360)
chr4 (650-704)||(31095078-31095131)
chr4 (499-541)||(53769786-53769828)
chr4 (640-681)||(22519313-22519354)
chr4 (422-463)||(22519817-22519858)
chr4 (643-704)||(48194179-48194239)
[»] chr2 (15 HSPs)
chr2 (499-735)||(4558769-4559007)
chr2 (503-754)||(8198509-8198759)
chr2 (503-754)||(8203269-8203519)
chr2 (671-754)||(45385838-45385921)
chr2 (640-754)||(4923428-4923542)
chr2 (775-842)||(8265959-8266027)
chr2 (640-735)||(42053964-42054059)
chr2 (499-580)||(6739472-6739554)
chr2 (646-735)||(3289442-3289531)
chr2 (484-544)||(42054042-42054102)
chr2 (686-752)||(4558680-4558745)
chr2 (512-565)||(4923553-4923607)
chr2 (677-735)||(8198419-8198477)
chr2 (677-735)||(8203179-8203237)
chr2 (681-756)||(32546464-32546538)
[»] chr6 (20 HSPs)
chr6 (499-741)||(16419591-16419837)
chr6 (500-627)||(196111-196238)
chr6 (643-754)||(12458392-12458504)
chr6 (597-735)||(33547750-33547889)
chr6 (484-632)||(17411121-17411270)
chr6 (502-626)||(28477384-28477509)
chr6 (502-626)||(29789836-29789961)
chr6 (484-673)||(7004200-7004390)
chr6 (640-736)||(10544282-10544376)
chr6 (518-614)||(32548138-32548235)
chr6 (648-704)||(7202300-7202356)
chr6 (505-588)||(33547849-33547933)
chr6 (427-466)||(17411092-17411131)
chr6 (527-632)||(7202313-7202419)
chr6 (507-580)||(10544136-10544210)
chr6 (526-626)||(29693282-29693383)
chr6 (640-737)||(31314513-31314609)
chr6 (515-609)||(9405267-9405362)
chr6 (662-735)||(196063-196135)
chr6 (640-681)||(33547744-33547785)
[»] chr7 (23 HSPs)
chr7 (484-754)||(41331168-41331439)
chr7 (499-754)||(18128375-18128632)
chr7 (643-736)||(30551947-30552040)
chr7 (643-736)||(6589558-6589651)
chr7 (660-739)||(12422044-12422123)
chr7 (649-756)||(32804629-32804736)
chr7 (647-735)||(1532197-1532285)
chr7 (558-746)||(20389633-20389822)
chr7 (640-735)||(28003341-28003434)
chr7 (499-585)||(48447315-48447402)
chr7 (642-735)||(5755594-5755685)
chr7 (499-588)||(12264801-12264890)
chr7 (499-578)||(12422262-12422342)
chr7 (652-756)||(12422352-12422455)
chr7 (556-756)||(21920965-21921164)
chr7 (499-550)||(28002279-28002330)
chr7 (656-721)||(32918529-32918595)
chr7 (643-704)||(1532441-1532501)
chr7 (660-736)||(6586862-6586938)
chr7 (505-545)||(32857850-32857890)
chr7 (807-842)||(21595127-21595162)
chr7 (655-734)||(48447283-48447362)
chr7 (641-698)||(5762696-5762753)
[»] scaffold0591 (1 HSPs)
scaffold0591 (618-756)||(3866-4003)
[»] chr8 (19 HSPs)
chr8 (649-735)||(2277209-2277295)
chr8 (656-736)||(27532989-27533069)
chr8 (640-719)||(37064689-37064768)
chr8 (652-754)||(15907689-15907790)
chr8 (640-754)||(15907944-15908058)
chr8 (484-736)||(2510015-2510263)
chr8 (672-754)||(12807666-12807748)
chr8 (484-614)||(3806871-3807000)
chr8 (427-469)||(18080603-18080645)
chr8 (643-739)||(32566875-32566969)
chr8 (649-737)||(2967707-2967794)
chr8 (640-735)||(3806998-3807091)
chr8 (499-631)||(12189869-12190002)
chr8 (499-631)||(12434297-12434430)
chr8 (423-457)||(27533035-27533069)
chr8 (649-719)||(45445141-45445210)
chr8 (666-758)||(41123-41216)
chr8 (485-549)||(8453098-8453163)
chr8 (662-707)||(32566724-32566769)
[»] chr1 (22 HSPs)
chr1 (499-735)||(363615-363853)
chr1 (499-734)||(47726457-47726693)
chr1 (499-734)||(47747763-47747999)
chr1 (643-736)||(16554303-16554396)
chr1 (500-630)||(29954870-29955000)
chr1 (646-735)||(18470189-18470279)
chr1 (640-735)||(802251-802346)
chr1 (647-754)||(12656368-12656474)
chr1 (649-735)||(16026108-16026194)
chr1 (560-756)||(11016877-11017075)
chr1 (499-565)||(26706207-26706274)
chr1 (640-735)||(46530163-46530258)
chr1 (647-704)||(48130213-48130268)
chr1 (652-741)||(48130428-48130516)
chr1 (655-754)||(363806-363906)
chr1 (640-719)||(26706353-26706432)
chr1 (652-754)||(46530411-46530517)
chr1 (776-842)||(2125101-2125168)
chr1 (499-545)||(18470384-18470430)
chr1 (643-704)||(16026346-16026406)
chr1 (647-704)||(18470439-18470495)
chr1 (484-632)||(47600499-47600648)
[»] chr3 (8 HSPs)
chr3 (496-731)||(30534432-30534666)
chr3 (499-735)||(51265744-51265984)
chr3 (547-704)||(44291025-44291182)
chr3 (640-736)||(44291413-44291509)
chr3 (650-754)||(48200367-48200471)
chr3 (643-704)||(51265679-51265739)
chr3 (499-565)||(50898882-50898948)
chr3 (653-754)||(1662257-1662357)


Alignment Details
Target: chr5 (Bit Score: 1065; Significance: 0; HSPs: 26)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 1065; E-Value: 0
Query Start/End: Original strand, 1 - 1182
Target Start/End: Original strand, 37704455 - 37705636
Alignment:
1 ccaaaaaggttgacttattagattgtttgcaaattgagtctacgtattcccttattttgttttgggggtgcttttcataaacatatactgatatgacatt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37704455 ccaaaaaggttgacttattagattgtttgcaaattgagtctacgtattcccttattttgttttgggggtgcttttcataaacatatactgatatgacatt 37704554  T
101 tggcaacaatattaattcagtaaccatcatagaaaagtttggtgttcattaaactaaataatatcttcgaagaccagactttttgaacgtaattagcacg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37704555 tggcaacaatattaattcagtaaccatcatagaaaagtttggtgttcattaaactaaataatatcttcgaagaccagactttttgaacgtaattagcacg 37704654  T
201 aaagttggaatcttatttcaagttgtgataagataacaaattcatttaagtagcaatcacagtgagtaatgtgcttaaaaatacacctgaaatgaagaaa 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37704655 aaagttggaatcttatttcaagttgtgataagataacaaattcatttaagtagcaatcacagtgagtaatgtgcttaaaaatacacctgaaatgaagaaa 37704754  T
301 ataacattaattgtatttagaatcggagacttagacttcttcaaatgtacatactttaaagagcaaattacgatacttttaagttatttaattataacaa 400  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
37704755 ataacattaattgtatttagaatcggagacttagacttcttcaaatgtacatactttaaagagcaaattacgagacttttaagttatttaattataacaa 37704854  T
401 atcggnnnnnnnnnnnnnnnncgtaccacttacgtcatttaagttatttaattataacaagttagttatgtagttgctcaaaaaacaagttagttatgta 500  Q
    |||||                |||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37704855 atcggttttttaagattttttcgtatcacttgcgtcatttaagttatttaattataacaagttagttatgtagttgctcaaaaaacaagttagttatgta 37704954  T
501 agtatttttcataacacttaggtcgtttaagttatttaattgtaactttaggtcccgaataacttgcagttttaagatctgaaatccctcaatttcttac 600  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
37704955 agtatttttcgtaacacttaggtcgtttaagttatttaattgtaactttaggtcccgaataacttgcagttttaagatctgaaatccctcaatttgttac 37705054  T
601 agttaaatagcttagaggacctaattggtacgnnnnnnnttaaaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaact 700  Q
    ||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
37705055 agttaaatagcttagaggacctaattggtacgaaaaaaattaaaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaatct 37705154  T
701 taaatgatcaatttcttacaactaaataacttaaaagacttatggtgtaatttaacatttattttatgtacgtgttttttgtatggttcttaactaaact 800  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37705155 taaatgaccaatttcttacaactaaataacttaaaagacttatggtgtaatttaacatttattttatgtacgtgttttttgtatggttcttaactaaact 37705254  T
801 acaaaaatttctttaaatttataattttttcaaagtttgttacagcacaaaagaaaatgcattgagcatataaaaagaaaaagtatcagatgtcatcgga 900  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
37705255 acaaaaatttctttaaatttataatttcttcaaagtttgttacagcacaaaagaaaatgcattgagcatataaaaagaaaaagtatcagatgccatcgga 37705354  T
901 tatcgatactctactcgtgagttctacggtagaccacctttataattggttcatcatggaccacatttcttatatttacgactaagtgggtgacttgatt 1000  Q
    ||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37705355 tatcgatactcaactcgtgggttctacggtagaccacctttataattggttcatcatggaccacatttcttatatttacgactaagtgggtgacttgatt 37705454  T
1001 gatgtttgttcagtgcaagctacaaaacaaattacattctcccccatgatatttaacattattgcattcttagaactagattcaaactcacgacatctag 1100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37705455 gatgtttgttcagtgcaagctacaaaacaaattacattctcccccatgatatttaacattattgcattcttagaactagattcaaactcacgacatctag 37705554  T
1101 ttaagctgtaagagatcactttcgtcttaccgaagtaatcttgggttattttccgttgttttaatcaaacttgttgtgaatt 1182  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37705555 ttaagttgtaagagatcactttcgtcttaccgaagtaatcttgggttattttccgttgttttaatcaaacttgttgtgaatt 37705636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 228; E-Value: 1e-125
Query Start/End: Original strand, 1 - 364
Target Start/End: Original strand, 37698974 - 37699349
Alignment:
1 ccaaaaaggttgacttattagattgtttgcaaa--ttgagtctacgtattcccttattttgttttgggggtgcttttcataaacatatactgatatgaca 98  Q
    |||||||| |||| |||||||||||||| ||||  ||||||||| ||||||||||||||||| ||||||||||||||||||| | |||||||||||||||    
37698974 ccaaaaagtttgagttattagattgtttacaaacattgagtctaggtattcccttattttgtgttgggggtgcttttcataaccgtatactgatatgaca 37699073  T
99 tttggcaacaatattaattcagtaaccatcatagaaaagtttggtgttcattaaactaaataatatcttcgaagacc-agactttttgaacgtaattagc 197  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| ||| ||| |||||||| |||||||||||||    
37699074 tttggcaacaatattaattcagtaacaatcatagaaaagtttggtgttcattaaactaaataacatcttggaaaaccaagacttttcgaacgtaattagc 37699173  T
198 acgaaagttggaatcttatttcaagttgtg---ataagataacaaattcatttaagtagcaatcacagtgagtaatgtgcttaaaaatacacctgaaatg 294  Q
    || ||||||||||||||||| |||||||||   |||||||||||||||||||||||||||||||| | |||||||| ||||||||||||||||| |||||    
37699174 actaaagttggaatcttattgcaagttgtgataataagataacaaattcatttaagtagcaatcagaatgagtaatttgcttaaaaatacacctaaaatg 37699273  T
295 aagaaaat------aacattaattgtatttagaatcggagacttagacttcttcaaatgtacatactttaaagagc 364  Q
    ||||||||      |||||||||||||||||| | ||||||||||||||||||||| || ||| ||||||||||||    
37699274 aagaaaataataacaacattaattgtatttagcaacggagacttagacttcttcaactgaacagactttaaagagc 37699349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 165; E-Value: 1e-87
Query Start/End: Original strand, 1 - 304
Target Start/End: Original strand, 37437521 - 37437823
Alignment:
1 ccaaaaaggttgacttattagattgtttgcaaattgagtctacgtattcccttattttgttttgggggtgcttttcataaacatatactgatatgacatt 100  Q
    ||||||||  |||||||||||||||||| |||||| ||||||  ||||||||| ||||  | ||||| |||||||||||| | |||| |||||||||| |    
37437521 ccaaaaagtctgacttattagattgtttacaaattcagtctagctattcccttgttttaatgtgggg-tgcttttcataaccgtatagtgatatgacaat 37437619  T
101 tggcaacaatattaattcagtaaccatcatagaaaagtttggtgttcattaaactaaataatatcttcgaagacc-agactttttgaacgtaattagcac 199  Q
    ||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| || || ||||||| |||||||| |||||||||||||      
37437620 tggcaacaatattaattcaataacaatcatagaaaagtttggtgttcattaaactaaataacatattggaagaccaagacttttcgaacgtaattagc-- 37437717  T
200 gaaagttggaatcttatttcaagttgtg---ataagataacaaattcatttaagtagcaatcacagtgagtaatgtgcttaaaaatacacctgaaatgaa 296  Q
      |||||||||||||||| |||||||||   |||||||||||||||||||||||||||||||| | |||||||| |||||||||||||||||||||||||    
37437718 --aagttggaatcttattgcaagttgtgataataagataacaaattcatttaagtagcaatcagaatgagtaatttgcttaaaaatacacctgaaatgaa 37437815  T
297 gaaaataa 304  Q
    ||||||||    
37437816 gaaaataa 37437823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 111; E-Value: 2e-55
Query Start/End: Original strand, 758 - 960
Target Start/End: Original strand, 37437914 - 37438116
Alignment:
758 tttattttatgtacgtgttttttgtatggttcttaactaaactacaaaaatttctttaaatttataattttttcaaagtttgttacagcacaaaagaaaa 857  Q
    ||||||||||||   | |||||| ||||||||||||||||||||||||||||||||||||||||||||||  |||||| || ||| |||||| |||||||    
37437914 tttattttatgtgttttttttttctatggttcttaactaaactacaaaaatttctttaaatttataatttcctcaaagcttattatagcacataagaaaa 37438013  T
858 tgcattgagcatataaaaagaaaaagtatcagatgtcatcggatatcgatactctactcgtgagttctacggtagaccacctttataattggttcatcat 957  Q
    |||| |||||||||||||||||||||||| |  ||||||  |||||||||||||||||  |||||||||| ||| |||||||||||||  ||||||||||    
37438014 tgcactgagcatataaaaagaaaaagtattaagtgtcatatgatatcgatactctactattgagttctactgtaaaccacctttataagcggttcatcat 37438113  T
958 gga 960  Q
    |||    
37438114 gga 37438116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 79; E-Value: 3e-36
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 37698637 - 37698864
Alignment:
1 ccaaaaaggttgacttattagattgtttgcaaattgagtctacgtattcccttattttgttttgggggtgcttttcataaacatatactgatatgacatt 100  Q
    |||||||| ||||||||||||||||||| ||||||||||||| ||||||||||||||||||                  | | |||| |||||||||| |    
37698637 ccaaaaagtttgacttattagattgtttacaaattgagtctaagtattcccttattttgttg-----------------accgtatagtgatatgacaat 37698719  T
101 tggcaacaatattaattcagtaaccatcatagaaaagtttggtgttcattaaactaaataatatcttcgaagacca-gactttttgaacgtaatta---- 195  Q
    |||||||||||||||        | |||||| ||||||||||||||| ||||||||||||| ||||| |||||||| |||||||| ||||||||||        
37698720 tggcaacaatattaa--------caatcatacaaaagtttggtgttcgttaaactaaataacatcttggaagaccaagacttttttaacgtaattaatta 37698811  T
196 gcacgaaagttggaatcttatttcaagttgtgataagataacaaattcattta 248  Q
    |||| ||||||||||||||||| ||||||||||||||||||||||||||||||    
37698812 gcactaaagttggaatcttattgcaagttgtgataagataacaaattcattta 37698864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 72; E-Value: 4e-32
Query Start/End: Original strand, 966 - 1165
Target Start/End: Original strand, 37438187 - 37438386
Alignment:
966 tttcttatatttacgactaagtgggtgacttgattgatgtttgttcagtgcaagctacaaaacaaattacattctcccccatgatatttaacattattgc 1065  Q
    |||| ||||||| ||||||||  ||||||||||||| ||| |||||||||| |||||  ||  |  |||||||||||| ||||| |||||||||| || |    
37438187 tttcctatatttgcgactaagacggtgacttgattggtgtatgttcagtgcgagctaataataattttacattctcccacatgagatttaacattgttac 37438286  T
1066 attcttagaactagattcaaactcacgacatctagttaagctgtaagagatcactttcgtcttaccgaagtaatcttgggttattttccgttgttttaat 1165  Q
    ||||  |||  | ||||||||||||||||||||  ||| |||| ||||| |||||||| ||||||| || |||||||||||||||||  |||||||||||    
37438287 attcccagagttggattcaaactcacgacatctgattaggctggaagaggtcactttcatcttacccaactaatcttgggttattttatgttgttttaat 37438386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 64; E-Value: 2e-27
Query Start/End: Original strand, 851 - 958
Target Start/End: Original strand, 37700646 - 37700753
Alignment:
851 aagaaaatgcattgagcatataaaaagaaaaagtatcagatgtcatcggatatcgatactctactcgtgagttctacggtagaccacctttataattggt 950  Q
    ||||||||||| |||||| ||||||||||||  ||| |  ||||||||||||| ||||||||||||||||||||||| ||||||||| ||||||| ||||    
37700646 aagaaaatgcactgagcacataaaaagaaaacatattaagtgtcatcggatattgatactctactcgtgagttctaccgtagaccacttttataagtggt 37700745  T
951 tcatcatg 958  Q
    ||||||||    
37700746 tcatcatg 37700753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 60; E-Value: 6e-25
Query Start/End: Original strand, 1179 - 1238
Target Start/End: Original strand, 37704400 - 37704459
Alignment:
1179 aattgattagcctctatttatataggaaacataacctgaaactaaggggcaaggaccaaa 1238  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37704400 aattgattagcctctatttatataggaaacataacctgaaactaaggggcaaggaccaaa 37704459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 970 - 1160
Target Start/End: Original strand, 37700838 - 37701026
Alignment:
970 ttatatttacgactaagtgggtgacttgattgatgtttgttcagtgcaagctacaaaacaaattacattctcccccatgatatttaacattattgcattc 1069  Q
    |||||||||||| ||||  |||||||||||||||||||    ||  | |||||||||  |  |||||||||||||||| | |||||||||  ||||||||    
37700838 ttatatttacgattaagatggtgacttgattgatgttta---agaacgagctacaaataattttacattctcccccataaaatttaacatggttgcattc 37700934  T
1070 ttagaactagattcaaactcacgacatctagttaagctgtaagagatcactttcgtcttaccgaagtaatc-ttgggttattttccgttgtt 1160  Q
      | ||||  ||||||||||||||||||  ||||||||| |||| ||||||||| ||||||  || ||||| |||||||||||||| |||||    
37700935 ccataactgaattcaaactcacgacatccggttaagctggaagatatcactttcatcttactcaaataatctttgggttattttcccttgtt 37701026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 53; E-Value: 8e-21
Query Start/End: Original strand, 1182 - 1238
Target Start/End: Original strand, 37437469 - 37437525
Alignment:
1182 tgattagcctctatttatataggaaacataacctgaaactaaggggcaaggaccaaa 1238  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
37437469 tgattagcctctatttatataggaaacataacttgaaactaaggggcaaggaccaaa 37437525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 1179 - 1238
Target Start/End: Original strand, 37698582 - 37698641
Alignment:
1179 aattgattagcctctatttatataggaaacataacctgaaactaaggggcaaggaccaaa 1238  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||    
37698582 aattgattagcctctatttatataggaaacataacctgaaactacggggaaaggaccaaa 37698641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 490 - 632
Target Start/End: Original strand, 34599459 - 34599603
Alignment:
490 ttagttatgtaagtatttttcataacacttaggtcgtttaagttatttaattgtaac-tttaggtcccgaataacttgcagttttaagatctgaaat-cc 587  Q
    |||||||| |||||||||||| |||  |||| ||| |||||||| |||||||||||| ||||||||| ||||||||| || ||||||||||| |||| ||    
34599459 ttagttatttaagtatttttcttaatgcttaagtcctttaagttgtttaattgtaacttttaggtccagaataacttacatttttaagatctaaaatacc 34599558  T
588 ctcaatttcttacagttaaatagcttagaggacctaattggtacg 632  Q
    |  || || |||| |||||||| |||| | ||||||||| |||||    
34599559 caaaaattgttacggttaaataacttaaatgacctaattagtacg 34599603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 43; E-Value: 0.000000000000008
Query Start/End: Original strand, 484 - 632
Target Start/End: Complemental strand, 2143394 - 2143247
Alignment:
484 aacaagttagttatgtaagtatttttcataacacttaggtcgtttaagttatttaattgtaacttt-aggtcccgaataacttgcagttttaagatctga 582  Q
    |||||||||||  | | |||||||||| ||||| ||||||  ||||||||||||||||| |||||| ||| |||||||||||| ||  |||||||| | |    
2143394 aacaagttagtcctttcagtatttttcgtaacatttaggttttttaagttatttaattgaaactttgaggccccgaataacttacatgtttaagatataa 2143295  T
583 aatccctcaatttcttacagttaaatagcttagaggacctaattggtacg 632  Q
    ||||||  || || ||  ||||||||| |||| ||||||||||| |||||    
2143294 aatcccctaaattgtt--agttaaataacttaaaggacctaattagtacg 2143247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 40; E-Value: 0.0000000000005
Query Start/End: Original strand, 512 - 735
Target Start/End: Original strand, 13953394 - 13953616
Alignment:
512 taacacttaggtcgtttaagttatttaattgtaactttaggtccc-gaataacttgcagttttaagatctgaaatccctcaatttcttacagttaaatag 610  Q
    ||||| ||| ||| ||||| |||||||| |||||||||  | ||  ||||||||| || ||||| | |||||||||||| || || ||||  |||||||     
13953394 taacatttaagtcctttaaattatttaactgtaacttttagaccttgaataacttacatttttagg-tctgaaatcccttaaatttttacgattaaataa 13953492  T
611 cttagaggacctaattggtacgnnnnnnnttaaaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatca 710  Q
    |||| | ||| |||||||||||       ||||| ||| ||||||||| |||||||||||||||| ||| |||| |||| | ||||||||||||  | ||    
13953493 cttaaaagacgtaattggtacggaaaaacttaaaagacaaacttgttacaattaattaacttaaatgacttaagcggtatg-aaaaaacttaaaaaacca 13953591  T
711 atttcttacaactaaataacttaaa 735  Q
    |||| ||| || |||| ||||||||    
13953592 atttattataattaaacaacttaaa 13953616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 38; E-Value: 0.000000000008
Query Start/End: Original strand, 662 - 739
Target Start/End: Complemental strand, 1629837 - 1629760
Alignment:
662 ttaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaagac 739  Q
    |||| ||||||||||||| ||| || |||| |||||||||||| |||| |||| |||||| ||| |||||||||||||    
1629837 ttaaataacttaaaggacttaattgctacggaaaaaacttaaaggatcgatttgttacaattaattaacttaaaagac 1629760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 640 - 756
Target Start/End: Complemental strand, 1629799 - 1629683
Alignment:
640 ttaaaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaagac 739  Q
    |||||||| | | |||||| |||||||||||||||| ||||||| | ||||  ||||   |||||  |  ||||| |||||| ||||||||||||| |||    
1629799 ttaaaggatcgatttgttacaattaattaacttaaaagacctaatttgtacagaaaatttttaaagaacgaatttattacaattaaataacttaaaggac 1629700  T
740 ttatggtgtaatttaac 756  Q
    || ||||||||||||||    
1629699 ttttggtgtaatttaac 1629683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 640 - 756
Target Start/End: Original strand, 29532047 - 29532161
Alignment:
640 ttaaaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaagac 739  Q
    ||||| ||||||||| ||| | ||||||||| ||||| | ||||||| |||| |||||| ||||| | ||||||| |||||| | |||||||| ||||||    
29532047 ttaaatgaccaactttttacagttaattaacataaagaagctaagtgatacg-aaaaaatttaaaggttcaatttgttacaattgaataactt-aaagac 29532144  T
740 ttatggtgtaatttaac 756  Q
     |||| |||||||||||    
29532145 atatgatgtaatttaac 29532161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 484 - 587
Target Start/End: Original strand, 26325678 - 26325781
Alignment:
484 aacaagttagttatgtaagtatttttcataacacttaggtcgtttaagttatttaattgtaactttaggtcccgaataacttgcagttttaagatctgaa 583  Q
    ||||||||||| || ||||||||| |  |||||||||  || ||||| |||||||||| ||||||||| ||| |||||||||  | |||||| || ||||    
26325678 aacaagttagtcatttaagtatttattgtaacacttaaatcctttaaattatttaattataactttagatcctgaataacttatatttttaatatttgaa 26325777  T
584 atcc 587  Q
    ||||    
26325778 atcc 26325781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 642 - 683
Target Start/End: Original strand, 2143379 - 2143420
Alignment:
642 aaaggaccaacttgttataattaattaacttaaaggacctaa 683  Q
    ||||||| ||||||||| ||||||||||||||||||||||||    
2143379 aaaggactaacttgttacaattaattaacttaaaggacctaa 2143420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 650 - 735
Target Start/End: Complemental strand, 30384297 - 30384213
Alignment:
650 aacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaa 735  Q
    ||||||||| |||||| ||||||||| ||| |||||  |||| |||||||||||| ||  ||||| |||||| |||||||||||||    
30384297 aacttgttacaattaaataacttaaaagacgtaagtaatacg-aaaaaacttaaaagacaaatttgttacaattaaataacttaaa 30384213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 487 - 535
Target Start/End: Complemental strand, 38458819 - 38458771
Alignment:
487 aagttagttatgtaagtatttttcataacacttaggtcgtttaagttat 535  Q
    |||||||| || ||||||||||||||||||||| |||| ||||||||||    
38458819 aagttagtcatttaagtatttttcataacacttgggtcctttaagttat 38458771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 650 - 737
Target Start/End: Complemental strand, 37704917 - 37704830
Alignment:
650 aacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaag 737  Q
    |||||||||||||||| ||||||||| |||  ||||| |||| ||||| ||||||  | | |||| ||| || |||||||||||||||    
37704917 aacttgttataattaaataacttaaatgacgcaagtgatacgaaaaaatcttaaaaaaccgatttgttataattaaataacttaaaag 37704830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 641 - 704
Target Start/End: Complemental strand, 41232964 - 41232901
Alignment:
641 taaaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaa 704  Q
    |||| ||||||||| ||| |||||||| |||||||||| ||||||||||   ||||||||||||    
41232964 taaaagaccaacttattacaattaattgacttaaaggatctaagtggtatcaaaaaaacttaaa 41232901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 505 - 565
Target Start/End: Original strand, 29531914 - 29531975
Alignment:
505 tttttcataacacttaggtcgtttaagttatttaattgtaa-ctttaggtcccgaataactt 565  Q
    |||||| || || ||| ||| ||||||||||||||||||||  |||||||||||||||||||    
29531914 tttttcgtatcatttacgtcatttaagttatttaattgtaatttttaggtcccgaataactt 29531975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 422 - 463
Target Start/End: Complemental strand, 37705145 - 37705104
Alignment:
422 cgtaccacttacgtcatttaagttatttaattataacaagtt 463  Q
    ||||||||||| ||| ||||||||| ||||||||||||||||    
37705145 cgtaccacttaggtcctttaagttaattaattataacaagtt 37705104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 640 - 736
Target Start/End: Original strand, 38458805 - 38458899
Alignment:
640 ttaaaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaa 736  Q
    ||||| ||| ||||| ||| ||| || ||||||||| ||  ||||||||||| ||||||||||||  |  ||||| |||||| ||||||||||||||    
38458805 ttaaatgactaacttattacaataaaataacttaaaagatataagtggtacgaaaaaaacttaaa--actaatttattacaattaaataacttaaaa 38458899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 107; Significance: 5e-53; HSPs: 28)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 107; E-Value: 5e-53
Query Start/End: Original strand, 128 - 364
Target Start/End: Complemental strand, 16841109 - 16840857
Alignment:
128 catagaaaagtttggtgttcattaaactaaataatatcttcgaagacc-agactttttgaacgtaattagcacgaaagttggaatcttatttcaagttgt 226  Q
    |||| |||||||||||||| | |||||||||||| ||||| ||||||| ||||||||||||||||||||||||  |||||||||||||||| ||||||||    
16841109 catacaaaagtttggtgtttaataaactaaataaaatcttggaagaccaagactttttgaacgtaattagcac-taagttggaatcttattgcaagttgt 16841011  T
227 g------ataagataacaaattcatttaagtagcaatcacagtgagtaatgtgcttaaaa----atacacctgaaatgaagaaaat------aacattaa 310  Q
    |      ||||||||||||||||||||||||| |||||||| ||| |||| |||||||||    ||||||||||||||||||||||      ||||||||    
16841010 gatattaataagataacaaattcatttaagtaccaatcacaatgaataatttgcttaaaaatatatacacctgaaatgaagaaaataataacaacattaa 16840911  T
311 ttgtatttagaatcggagacttagacttcttcaaatgtacatactttaaagagc 364  Q
     ||||||||||| |||||||||||||||| |||| | | |||||||||||||||    
16840910 atgtatttagaagcggagacttagacttcgtcaactatccatactttaaagagc 16840857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 75; E-Value: 6e-34
Query Start/End: Original strand, 966 - 1129
Target Start/End: Complemental strand, 16840535 - 16840376
Alignment:
966 tttcttatatttacgactaagtgggtgacttgattgatgtttgttcagtgcaagctacaaaacaaattacattctcccccatgatatttaacattattgc 1065  Q
    |||||||||||||||||||||  | ||||||||||||||||||||| |    |||||||||  |  |||||||||||||| ||| |||||||||| ||||    
16840535 tttcttatatttacgactaagacgatgacttgattgatgtttgttcgg----agctacaaataattttacattctcccccgtgacatttaacattgttgc 16840440  T
1066 attcttagaactagattcaaactcacgacatctagttaagctgtaagagatcactttcgtctta 1129  Q
    ||||| |||||  |||||||||||||| ||||| ||||||||| |||||||||||||| |||||    
16840439 attctcagaaccggattcaaactcacggcatctggttaagctggaagagatcactttcatctta 16840376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 75; E-Value: 6e-34
Query Start/End: Original strand, 777 - 950
Target Start/End: Complemental strand, 16840796 - 16840622
Alignment:
777 ttttgtatggttcttaactaaactacaaaaatttctttaaatttataattttttcaaagtttgttacagcacaaaagaaaatgcattgagcatataaaaa 876  Q
    |||| ||| ||| ||||||||||||||||||||||||||||| |||||||| |||||||||||||| | || | ||||||||| | | ||||||||||||    
16840796 ttttttatagtttttaactaaactacaaaaatttctttaaatctataatttattcaaagtttgttataacaaataagaaaatgtactaagcatataaaaa 16840697  T
877 gaaaaagtatcagatgtcatcggata-tcgatactctactcgtgagttctacggtagaccacctttataattggt 950  Q
    |||||||||| |  ||||||  |||| | ||||||||||||||||||||||  ||| ||||| ||||||| ||||    
16840696 gaaaaagtattaagtgtcataagatatttgatactctactcgtgagttctaaagtaaaccacttttataagtggt 16840622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 72; E-Value: 4e-32
Query Start/End: Original strand, 1053 - 1168
Target Start/End: Complemental strand, 16840378 - 16840263
Alignment:
1053 ttaacattattgcattcttagaactagattcaaactcacgacatctagttaagctgtaagagatcactttcgtcttaccgaagtaatcttgggttatttt 1152  Q
    |||||||| ||||||||  | |||  |||||||||||||||||||| ||||||||| |||||||||||||| ||||||| |||||||| |||||||||||    
16840378 ttaacattgttgcattcccataaccggattcaaactcacgacatctggttaagctggaagagatcactttcatcttacccaagtaatcatgggttatttt 16840279  T
1153 ccgttgttttaatcaa 1168  Q
    ||||||||||||||||    
16840278 ccgttgttttaatcaa 16840263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 484 - 615
Target Start/End: Original strand, 22519386 - 22519518
Alignment:
484 aacaagttagttatgtaagtatttttcataacacttaggtcgtttaagttatttaattgtaac-tttaggtcccgaataacttgcagttttaagatctga 582  Q
    |||||||||||  | |||||||||||| ||||||||||||| ||||||||||||||||||||| |||||||||| |||||||| || |||||||||||||    
22519386 aacaagttagtcctttaagtatttttcgtaacacttaggtcctttaagttatttaattgtaacttttaggtcccaaataacttacatttttaagatctga 22519485  T
583 aatccctcaatttcttacagttaaatagcttag 615  Q
    |||||| ||| ||  ||| |||||||| |||||    
22519486 aatcccccaaattgctacggttaaataacttag 22519518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 57; E-Value: 3e-23
Query Start/End: Original strand, 484 - 735
Target Start/End: Original strand, 31095124 - 31095377
Alignment:
484 aacaagttagttatgtaagtatttttcataacacttaggtcgtttaagttatttaattgtaac-tttaggtcccgaataacttgcagttttaagatctga 582  Q
    ||||||||| | || |||||||| ||  ||||||||||||  ||||||||||||||||||||| ||||||||  ||||||||| || |||||||||||||    
31095124 aacaagttaatcatttaagtattgtttgtaacacttaggttctttaagttatttaattgtaacttttaggtcttgaataacttacatttttaagatctga 31095223  T
583 aatccctcaatttcttacagttaaatagcttagaggacctaattggtacgnnnnnnnttaaaggaccaacttgttataattaattaacttaaaggaccta 682  Q
    |||||   || ||  ||  || |||||||||| | ||||| ||||||| |       ||| ||||  ||||||||| || ||||||||||||| ||||||    
31095224 aatcctaaaaattgatatggtaaaatagcttaaatgaccttattggtaggaaaaaacttataggattaacttgttacaactaattaacttaaaagaccta 31095323  T
683 agtggtacgtaaaaaacttaaat-gatcaatttcttacaactaaataacttaaa 735  Q
    | ||||||| ||| || |||| | ||  ||||| |||||| |||||||||||||    
31095324 aatggtacgaaaataatttaagtggacaaatttattacaattaaataacttaaa 31095377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 56; E-Value: 1e-22
Query Start/End: Original strand, 640 - 754
Target Start/End: Original strand, 22519807 - 22519921
Alignment:
640 ttaaaggaccaacttgttataattaattaacttaaaggacctaagtggtac-gtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaaga 738  Q
    |||||||| ||||||||||||||||||||||||||| |||||||||||||| | ||||||||| || || |||||| |||||| ||||||| || |||||    
22519807 ttaaaggatcaacttgttataattaattaacttaaaagacctaagtggtacggaaaaaaactttaaggaccaatttgttacaattaaataa-tttaaaga 22519905  T
739 cttatggtgtaattta 754  Q
    | | ||||||||||||    
22519906 cctctggtgtaattta 22519921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 646 - 735
Target Start/End: Original strand, 48194394 - 48194483
Alignment:
646 gaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaa 735  Q
    ||||||||||||| | |||| |||||||||||||||||| |||||| ||||||| ||||||||||| || |||||| |||||||||||||    
48194394 gaccaacttgttacagttaaataacttaaaggacctaagaggtacgaaaaaaacgtaaatgatcaacttattacaattaaataacttaaa 48194483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 484 - 614
Target Start/End: Complemental strand, 49291335 - 49291205
Alignment:
484 aacaagttagttatgtaagtatttttcataacacttaggtcgtttaagttatttaattgtaactttaggtcccgaataacttgcagttttaagatctgaa 583  Q
    ||||||||||| || ||||||||||| |||||| ||| ||| ||||||||||||||||||||||||    ||||| |||||| || ||| ||||||||||    
49291335 aacaagttagtcatttaagtattttttataacatttaagtcttttaagttatttaattgtaacttttaaacccgagtaacttacattttgaagatctgaa 49291236  T
584 atccctcaatttcttacagttaaatagctta 614  Q
    || ||| || || ||||  ||||||| ||||    
49291235 attcctgaaattgttacgattaaataactta 49291205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 662 - 754
Target Start/End: Original strand, 33617920 - 33618010
Alignment:
662 ttaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaagacttatggtgtaattta 754  Q
    ||||||||||||||||||||||| ||||||  ||||||||||| || |||||| |||||| ||||||||||||| ||| | | ||||||||||    
33617920 ttaattaacttaaaggacctaagcggtacg--aaaaacttaaaggaccaatttattacaattaaataacttaaatgacctcttgtgtaattta 33618010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 499 - 735
Target Start/End: Complemental strand, 20141983 - 20141745
Alignment:
499 taagtatttttcataacacttaggtcgtttaagttatttaattgtaacttt-aggtcccgaataacttgcagttttaagatctgaaat-ccctcaatttc 596  Q
    |||||||||||| |||  |||| ||| |||||||| ||||||||||| ||| ||| ||  |||||||| || ||||||||||| |||| |||  || ||     
20141983 taagtatttttcgtaatgcttaagtc-tttaagttgtttaattgtaatttttaggcccataataacttacatttttaagatctaaaatacccaaaaatta 20141885  T
597 ttacagttaaatagcttagaggacctaattggtacgnnnnnnnttaaaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaa 696  Q
    |||| |||||||| |||| | ||||||||| |||||        | || ||||||||||||| ||||||||||| ||||| ||||||||| |||  ||||    
20141884 ttacggttaaataacttaaatgacctaattagtacgaataaaacttaaagaccaacttgttacaattaattaacataaagaacctaagtgatacaaaaaa 20141785  T
697 a-acttaaatgatcaatttcttacaactaaataacttaaa 735  Q
    | |||||||  | | | || |||||| |||||||||||||    
20141784 agacttaaagaacctacttattacaattaaataacttaaa 20141745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 647 - 735
Target Start/End: Complemental strand, 22889674 - 22889586
Alignment:
647 accaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaa 735  Q
    |||||||||||| |||| |||||||||||||| | ||| |||||  ||||||||| || || |||||| ||| || |||||||||||||    
22889674 accaacttgttacaatttattaacttaaaggatcaaagcggtacaaaaaaaactttaaggaccaatttattataattaaataacttaaa 22889586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 647 - 735
Target Start/End: Complemental strand, 22941338 - 22941250
Alignment:
647 accaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaa 735  Q
    |||||||||||| |||| |||||||||||||| | ||| |||||  ||||||||| || || |||||| ||| || |||||||||||||    
22941338 accaacttgttacaatttattaacttaaaggatcaaagcggtacaaaaaaaactttaaggaccaatttattataattaaataacttaaa 22941250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 1189 - 1224
Target Start/End: Complemental strand, 16841238 - 16841203
Alignment:
1189 cctctatttatataggaaacataacctgaaactaag 1224  Q
    ||||||||||||||||||||||||||||||||||||    
16841238 cctctatttatataggaaacataacctgaaactaag 16841203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 660 - 735
Target Start/End: Original strand, 53769786 - 53769861
Alignment:
660 aattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaa 735  Q
    |||||| ||| ||||| ||||||||||||| | |||| ||||||||||| ||||| |||||| ||||||| |||||    
53769786 aattaaataatttaaaagacctaagtggtatgaaaaatacttaaatgattaatttattacaattaaataatttaaa 53769861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 35; E-Value: 0.0000000005
Query Start/End: Original strand, 650 - 756
Target Start/End: Complemental strand, 2323372 - 2323266
Alignment:
650 aacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaagacttatggtgta 749  Q
    ||||||||| ||||||||||||| || || |||  ||||||  |||||||||||| |   ||||| |||||| ||||||| ||||| ||||| || ||||    
2323372 aacttgttacaattaattaacttgaaagaactacatggtaccaaaaaaacttaaagggctaatttgttacaattaaataatttaaaggacttttgatgta 2323273  T
750 atttaac 756  Q
    |||||||    
2323272 atttaac 2323266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 35; E-Value: 0.0000000005
Query Start/End: Original strand, 667 - 741
Target Start/End: Original strand, 42676809 - 42676883
Alignment:
667 taacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaagactt 741  Q
    ||||||||| |||||||||| |||| ||||||| |||| ||| || || |||||| ||| |||||||||||||||    
42676809 taacttaaatgacctaagtgatacgaaaaaaacataaaggattaacttgttacaattaattaacttaaaagactt 42676883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 427 - 464
Target Start/End: Original strand, 31095095 - 31095132
Alignment:
427 cacttacgtcatttaagttatttaattataacaagtta 464  Q
    |||||||||| |||||||||||||||||||||||||||    
31095095 cacttacgtcctttaagttatttaattataacaagtta 31095132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 484 - 549
Target Start/End: Complemental strand, 51580140 - 51580077
Alignment:
484 aacaagttagttatgtaagtatttttcataacacttaggtcgtttaagttatttaattgtaacttt 549  Q
    |||||||||||| | |||||||||||| ||||| ||||||| |||| |||||||||||||||||||    
51580140 aacaagttagttct-taagtatttttcgtaacatttaggtc-tttacgttatttaattgtaacttt 51580077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 650 - 733
Target Start/End: Original strand, 34013780 - 34013861
Alignment:
650 aacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataactta 733  Q
    ||||| ||||| |||||||| ||||||||| ||||| ||| | |||||  ||||||||| ||||| |||||| |||||||||||    
34013780 aacttattatatttaattaatttaaaggacttaagtagtatgaaaaaa--ttaaatgattaatttgttacaattaaataactta 34013861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 655 - 730
Target Start/End: Complemental strand, 22519448 - 22519373
Alignment:
655 gttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataac 730  Q
    |||| |||||| |||||||||||||||||||| |||| |||| ||||||| ||  || || |||||| ||||||||    
22519448 gttacaattaaataacttaaaggacctaagtgttacgaaaaatacttaaaggactaacttgttacaattaaataac 22519373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 641 - 736
Target Start/End: Original strand, 34717567 - 34717660
Alignment:
641 taaaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaa 736  Q
    |||| ||| ||||||||  |||||||||||||||| ||| || ||| |||| ||||||||||||| |  ||||| |||||| ||||||||||||||    
34717567 taaaagacaaacttgtttcaattaattaacttaaaagacttaggtgatacg-aaaaaacttaaat-acaaatttattacaattaaataacttaaaa 34717660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 640 - 691
Target Start/End: Original strand, 40070309 - 40070360
Alignment:
640 ttaaaggaccaacttgttataattaattaacttaaaggacctaagtggtacg 691  Q
    |||||||| |||||||||||| |||||||||||||| || ||||||| ||||    
40070309 ttaaaggatcaacttgttatatttaattaacttaaatgatctaagtgatacg 40070360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 650 - 704
Target Start/End: Complemental strand, 31095131 - 31095078
Alignment:
650 aacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaa 704  Q
    |||||||||||||||| ||||||||||||| |||||| || | ||||||||||||    
31095131 aacttgttataattaaataacttaaaggacgtaagtgatatg-aaaaaacttaaa 31095078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 499 - 541
Target Start/End: Complemental strand, 53769828 - 53769786
Alignment:
499 taagtatttttcataacacttaggtcgtttaagttatttaatt 541  Q
    ||||||||||||||| |||||||||| ||||| ||||||||||    
53769828 taagtatttttcataccacttaggtcttttaaattatttaatt 53769786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 640 - 681
Target Start/End: Complemental strand, 22519354 - 22519313
Alignment:
640 ttaaaggaccaacttgttataattaattaacttaaaggacct 681  Q
    ||||||||||| | |||||||||||| |||||||||||||||    
22519354 ttaaaggaccagcatgttataattaactaacttaaaggacct 22519313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 422 - 463
Target Start/End: Complemental strand, 22519858 - 22519817
Alignment:
422 cgtaccacttacgtcatttaagttatttaattataacaagtt 463  Q
    ||||||||||| ||| ||||||||| ||||||||||||||||    
22519858 cgtaccacttaggtcttttaagttaattaattataacaagtt 22519817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 643 - 704
Target Start/End: Complemental strand, 48194239 - 48194179
Alignment:
643 aaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaa 704  Q
    |||||||||||||||| | |||| ||||||||||  | ||||||||||| ||||||||||||    
48194239 aaggaccaacttgttacagttaagtaacttaaagagcgtaagtggtacg-aaaaaacttaaa 48194179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 95; Significance: 7e-46; HSPs: 15)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 95; E-Value: 7e-46
Query Start/End: Original strand, 499 - 735
Target Start/End: Original strand, 4558769 - 4559007
Alignment:
499 taagtatttttcataacacttaggtcgtttaagttatttaattgtaacttt-aggtcccgaataacttgcagttttaagatctgaaatccctcaatttct 597  Q
    |||||||||||| ||||||||||||| ||||| |||||||||||||||||| ||| |  |||||||||||| ||||||||||| |||| |||||| |  |    
4558769 taagtatttttcgtaacacttaggtcttttaatttatttaattgtaacttttaggccatgaataacttgcatttttaagatctaaaatacctcaaatagt 4558868  T
598 tacagttaaatagcttagaggacctaattggtac-gnnnnnnnttaaaggaccaacttgttataattaattaacttaaaggacctaagtggta-cgtaaa 695  Q
    ||| ||||||||||||| |||||||||||||||| |       |||||||| |||||||||| ||||||||||| ||||| |||||||| ||| |  |||    
4558869 tacggttaaatagcttaaaggacctaattggtacagacaaaacttaaaggaacaacttgttacaattaattaacataaagtacctaagttgtaccaaaaa 4558968  T
696 aaacttaaatgatcaatttcttacaactaaataacttaaa 735  Q
    ||||||||| ||||||||| |||||| |||||||||||||    
4558969 aaacttaaa-gatcaatttattacaattaaataacttaaa 4559007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 86; E-Value: 2e-40
Query Start/End: Original strand, 503 - 754
Target Start/End: Original strand, 8198509 - 8198759
Alignment:
503 tatttttcataacacttaggtcgtttaagttatttaattgtaacttt-aggtcccgaataacttgcagttttaagatctgaaatccctcaatttcttaca 601  Q
    |||||||| ||||||||||||  ||||||||||||||||| |||||| |||  || | |||||| || |||||||||||||||||||  || || ||||     
8198509 tatttttcttaacacttaggt--tttaagttatttaattgaaacttttaggctccaactaacttacatttttaagatctgaaatcccctaaattgttacg 8198606  T
602 gttaaatagcttagaggacctaattggtacgnnnnnnn-ttaaaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaact 700  Q
    |||||||| |||| |||||||||||||||||        ||||||| ||||||| ||| ||||||||| |||||||||||||||||||||| ||||||||    
8198607 gttaaataacttaaaggacctaattggtacggaaaaaacttaaagggccaacttattacaattaattatcttaaaggacctaagtggtacggaaaaaact 8198706  T
701 taaatgatcaatttcttacaactaaataacttaaaagacttatggtgtaattta 754  Q
    |||| || |||||| |||||| ||| ||||||||| || || |||| |||||||    
8198707 taaa-gaccaatttgttacaattaactaacttaaaggatttctggtataattta 8198759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 86; E-Value: 2e-40
Query Start/End: Original strand, 503 - 754
Target Start/End: Original strand, 8203269 - 8203519
Alignment:
503 tatttttcataacacttaggtcgtttaagttatttaattgtaacttt-aggtcccgaataacttgcagttttaagatctgaaatccctcaatttcttaca 601  Q
    |||||||| ||||||||||||  ||||||||||||||||| |||||| |||  || | |||||| || |||||||||||||||||||  || || ||||     
8203269 tatttttcttaacacttaggt--tttaagttatttaattgaaacttttaggctccaactaacttacatttttaagatctgaaatcccctaaattgttacg 8203366  T
602 gttaaatagcttagaggacctaattggtacgnnnnnnn-ttaaaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaact 700  Q
    |||||||| |||| |||||||||||||||||        ||||||| ||||||| ||| ||||||||| |||||||||||||||||||||| ||||||||    
8203367 gttaaataacttaaaggacctaattggtacggaaaaaacttaaagggccaacttattacaattaattatcttaaaggacctaagtggtacggaaaaaact 8203466  T
701 taaatgatcaatttcttacaactaaataacttaaaagacttatggtgtaattta 754  Q
    |||| || |||||| |||||| ||| ||||||||| || || |||| |||||||    
8203467 taaa-gaccaatttgttacaattaactaacttaaaggatttctggtataattta 8203519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 48; E-Value: 8e-18
Query Start/End: Original strand, 671 - 754
Target Start/End: Complemental strand, 45385921 - 45385838
Alignment:
671 ttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaagacttatggtgtaattta 754  Q
    ||||||||| ||||||||||| |||||||||||| |  |||||| |||||| ||||||||||||| ||| ||||||||||||||    
45385921 ttaaaggacgtaagtggtacgaaaaaaacttaaagggccaatttgttacaattaaataacttaaaggacctatggtgtaattta 45385838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 640 - 754
Target Start/End: Complemental strand, 4923542 - 4923428
Alignment:
640 ttaaaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaagac 739  Q
    ||||||||  ||||| ||| |||| |||||| ||||  |||||| ||||||| ||||||| |||||||||||||| ||| || |||| ||||||| ||||    
4923542 ttaaaggattaacttattacaatttattaacgtaaaaaacctaaatggtacggaaaaaacataaatgatcaatttattataattaaaaaacttaagagac 4923443  T
740 ttatggtgtaattta 754  Q
     |  |||||||||||    
4923442 atccggtgtaattta 4923428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 775 - 842
Target Start/End: Complemental strand, 8266027 - 8265959
Alignment:
775 ttttttgtatggttcttaactaaactacaaa-aatttctttaaatttataattttttcaaagtttgtta 842  Q
    ||||| ||||| ||||||||| ||||||| | ||||||||||||||||||||||| ||||| |||||||    
8266027 tttttcgtatgattcttaacttaactacatacaatttctttaaatttataattttctcaaattttgtta 8265959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 640 - 735
Target Start/End: Complemental strand, 42054059 - 42053964
Alignment:
640 ttaaaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaa 735  Q
    ||||||||| ||||||||| ||||||  ||||||||| ||||||||| ||   | |||||||||| ||| || || ||| ||||||||||||||||    
42054059 ttaaaggactaacttgttaaaattaaacaacttaaagaacctaagtgatataaacaaaacttaaaggattaacttattataactaaataacttaaa 42053964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 35; E-Value: 0.0000000005
Query Start/End: Original strand, 499 - 580
Target Start/End: Original strand, 6739472 - 6739554
Alignment:
499 taagtatttttcataacacttaggtcgtttaagttatttaattgt-aactttaggtcccgaataacttgcagttttaagatct 580  Q
    |||||||||||  ||||| ||||||| |||||||||||||||||| ||||||| | | | |||||||| || |||||||||||    
6739472 taagtattttttgtaacatttaggtcatttaagttatttaattgtaaactttaagcctctaataacttacatttttaagatct 6739554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 646 - 735
Target Start/End: Original strand, 3289442 - 3289531
Alignment:
646 gaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaa 735  Q
    ||||||||||||| |||||||| | ||||| ||  |||||| |||  |||||||||||| || |||||| |||||| ||||||| |||||    
3289442 gaccaacttgttacaattaattcaattaaaagatttaagtgatacaaaaaaaacttaaaagaccaatttattacaattaaataatttaaa 3289531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 484 - 544
Target Start/End: Original strand, 42054042 - 42054102
Alignment:
484 aacaagttagttatgtaagtatttttcataacacttaggtcgtttaagttatttaattgta 544  Q
    |||||||||||  | |||||||||||| || |||||||||  |||||||||||||||||||    
42054042 aacaagttagtcctttaagtatttttcctatcacttaggttctttaagttatttaattgta 42054102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 686 - 752
Target Start/End: Complemental strand, 4558745 - 4558680
Alignment:
686 ggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaagacttatggtgtaatt 752  Q
    |||||| |||||||||||| || |||||| |||||| |||||||||||| ||| |||| ||||||||    
4558745 ggtacgaaaaaaacttaaa-gaccaatttattacaattaaataacttaagagaattatcgtgtaatt 4558680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 512 - 565
Target Start/End: Original strand, 4923553 - 4923607
Alignment:
512 taacacttaggtcgtttaagttatttaattgtaac-tttaggtcccgaataactt 565  Q
    ||||||||||||  ||||||||||||||||| ||| ||||||| |||||||||||    
4923553 taacacttaggtactttaagttatttaattgcaacttttaggttccgaataactt 4923607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 677 - 735
Target Start/End: Complemental strand, 8198477 - 8198419
Alignment:
677 gacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaa 735  Q
    ||||||||||||||| |||||| |||||  | |||||| |||||| |||||||||||||    
8198477 gacctaagtggtacgaaaaaaatttaaagaaccaatttattacaattaaataacttaaa 8198419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 677 - 735
Target Start/End: Complemental strand, 8203237 - 8203179
Alignment:
677 gacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaa 735  Q
    ||||||||||||||| |||||| |||||  | |||||| |||||| |||||||||||||    
8203237 gacctaagtggtacgaaaaaaatttaaagaaccaatttattacaattaaataacttaaa 8203179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 681 - 756
Target Start/End: Original strand, 32546464 - 32546538
Alignment:
681 taagtggtacgtaaaa-aacttaaatgatcaatttcttacaactaaataacttaaaagacttatggtgtaatttaac 756  Q
    ||||||||||| |||| |||||||||||||||||| |||| | |||| ||||||||  || | ||||||||||||||    
32546464 taagtggtacgaaaaataacttaaatgatcaatttattacgattaaaaaacttaaa--acctctggtgtaatttaac 32546538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 88; Significance: 1e-41; HSPs: 20)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 88; E-Value: 1e-41
Query Start/End: Original strand, 499 - 741
Target Start/End: Complemental strand, 16419837 - 16419591
Alignment:
499 taagtatttttcataacacttaggtcgtttaagttatttaattgtaac-tttaggtcccgaataacttgcagttttaagatctgaaatccctcaatttct 597  Q
    ||||||||| || ||||||||||||| ||||||||||||||||| ||| |||||| ||| |||||||| || || |||||||| ||||||||||| || |    
16419837 taagtatttgtcgtaacacttaggtcttttaagttatttaattgaaacttttaggccccaaataacttacatttctaagatctaaaatccctcaaattgt 16419738  T
598 tacagttaaatagcttagaggacctaattggtacgnnnnnnnttaaaggaccaacttgttataattaattaacttaaaggacctaagtggtac---gtaa 694  Q
    ||| |||||||| |||| |||| | ||||||||||       ||||| ||||||||||||| |||||||||||||||| || |||| ||||||     ||    
16419737 tacggttaaataacttaaaggatcaaattggtacgaaaaaacttaaatgaccaacttgttacaattaattaacttaaatgatctaattggtacaaaagaa 16419638  T
695 aaaacttaaatgatcaatttcttacaactaaataacttaaaagactt 741  Q
    || |||| |||||||||||| |||||| ||||||||||||| |||||    
16419637 aatacttcaatgatcaatttgttacaattaaataacttaaaggactt 16419591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 500 - 627
Target Start/End: Complemental strand, 196238 - 196111
Alignment:
500 aagtatttttcataacacttaggtcgtttaagttatttaattgtaacttt-aggtcccgaataacttgcagttttaagatctgaaatccctcaatttctt 598  Q
    |||||| ||||  |||||||||||| |||||||||||||||||||||||| | | || ||||||||| || ||||||||| |||||| |||||| || ||    
196238 aagtatatttcgaaacacttaggtc-tttaagttatttaattgtaacttttaagccctgaataacttacatttttaagatatgaaatacctcaaattgtt 196140  T
599 acagttaaatagcttagaggacctaattg 627  Q
    || ||||| || |||| ||||||||||||    
196139 acggttaagtaacttaaaggacctaattg 196111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 643 - 754
Target Start/End: Original strand, 12458392 - 12458504
Alignment:
643 aaggaccaacttgttataattaattaacttaaaggacctaagtggtac-gtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaagactt 741  Q
    ||||||||||||||| ||||| ||||||||||||||||||||  |||| | ||||||||||||  | ||| || |||||| ||||||||||||| |||||    
12458392 aaggaccaacttgttttaatttattaacttaaaggacctaagaagtacgggaaaaaacttaaagtaccaaattgttacaattaaataacttaaaggactt 12458491  T
742 atggtgtaattta 754  Q
     | ||||||||||    
12458492 ctagtgtaattta 12458504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 597 - 735
Target Start/End: Complemental strand, 33547889 - 33547750
Alignment:
597 ttacagttaaatagcttagaggacctaattggtacgnnnnnnnttaaaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaa- 695  Q
    ||||| ||||||| |||| ||||||||| ||||| |       ||||| ||| ||||||||| |||||||||||||||||||| ||||||| ||  |||     
33547889 ttacaattaaataacttaaaggacctaaatggtatgaaaaaacttaaaagacaaacttgttacaattaattaacttaaaggacataagtggaacaaaaat 33547790  T
696 aaacttaaatgatcaatttcttacaactaaataacttaaa 735  Q
    ||||||||| || |||||| |||||| |||||||||||||    
33547789 aaacttaaaggaccaatttgttacaattaaataacttaaa 33547750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 484 - 632
Target Start/End: Original strand, 17411121 - 17411270
Alignment:
484 aacaagttagttatgtaagtatttttcataacacttaggtcgtttaagttatttaattgtaactttaggtc-ccgaataacttgcagttttaagatctga 582  Q
    |||||||||||  | ||| |||||||| ||| || || ||| ||| ||||||||||||||||| ||  ||| ||||||||||| || |||||||||||||    
17411121 aacaagttagtcttttaaatatttttcgtaatacataagtcttttgagttatttaattgtaacgtttagtctccgaataacttacatttttaagatctga 17411220  T
583 aatccctcaatttcttacagttaaatagcttagaggacctaattggtacg 632  Q
    |||||| ||| || ||||  ||||||| |||| || || |||||||||||    
17411221 aatcccccaaattattacgattaaataacttaaagtacataattggtacg 17411270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 502 - 626
Target Start/End: Complemental strand, 28477509 - 28477384
Alignment:
502 gtatttttcataacacttaggtcgtttaagttatttaattgtaacttt-aggtcccgaataacttgcagttttaagatctgaaatccctcaatttcttac 600  Q
    ||||||||||||||| ||||||  ||||| ||||||||| |||| ||| ||| |||||||||||| || ||||||||||| ||||| |  || || ||||    
28477509 gtatttttcataacagttaggttctttaaattatttaatcgtaatttttaggccccgaataacttacatttttaagatctaaaatcgcctaaattattac 28477410  T
601 agttaaatagcttagaggacctaatt 626  Q
    |||| |||| |||| || ||||||||    
28477409 agttcaataacttaaagaacctaatt 28477384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 502 - 626
Target Start/End: Complemental strand, 29789961 - 29789836
Alignment:
502 gtatttttcataacacttaggtcgtttaagttatttaattgtaacttt-aggtcccgaataacttgcagttttaagatctgaaatccctcaatttcttac 600  Q
    ||||||||||||||| ||||||  ||||| ||||||||| |||| ||| ||| |||||||||||| || ||||||||||| ||||| |  || || ||||    
29789961 gtatttttcataacagttaggttctttaaattatttaatcgtaatttttaggccccgaataacttacaattttaagatctaaaatcgcctaaattattac 29789862  T
601 agttaaatagcttagaggacctaatt 626  Q
    |||| |||| |||| || ||||||||    
29789861 agttcaataacttaaagaacctaatt 29789836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 484 - 673
Target Start/End: Original strand, 7004200 - 7004390
Alignment:
484 aacaagttagttatgtaagtatttttcataacacttaggtcgtttaagttatttaattgtaac-tttaggtcccgaataacttgcagttttaagatctga 582  Q
    |||||||||||  | |||||||||||  || |||||| ||| ||||||||||||||||| ||| ||||   || |||||||||  | ||||||||||| |    
7004200 aacaagttagtcctttaagtattttttgtatcacttatgtc-tttaagttatttaattgcaacatttaaaccctgaataacttatacttttaagatctaa 7004298  T
583 aatccctcaatttcttacagttaaatagcttagaggacctaattggtac-gnnnnnnnttaaaggaccaacttgttataattaattaactta 673  Q
    |||  ||||| || |||| |||||||| |||| || ||||||||||||| |        ||||||| |||||||||||||||||| ||||||    
7004299 aatttctcaaattgttacggttaaataacttaaagaacctaattggtacagagaaaacataaaggatcaacttgttataattaataaactta 7004390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 38; E-Value: 0.000000000008
Query Start/End: Original strand, 640 - 736
Target Start/End: Original strand, 10544282 - 10544376
Alignment:
640 ttaaaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaa 736  Q
    ||||| || |||||| ||||||||||||||||||| ||| |||| | ||||| ||||||||||||   ||||||| |||||  ||||||||||||||    
10544282 ttaaatgatcaacttattataattaattaacttaatggatctaactagtacgaaaaaaacttaaa--gtcaatttgttacagataaataacttaaaa 10544376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 38; E-Value: 0.000000000008
Query Start/End: Original strand, 518 - 614
Target Start/End: Complemental strand, 32548235 - 32548138
Alignment:
518 ttaggtcgtttaagttatttaattgtaac-tttaggtcccgaataacttgcagttttaagatctgaaatccctcaatttcttacagttaaatagctta 614  Q
    ||||||| ||||||||||||||||||||| ||||| ||||||||| ||| || ||||||||| | |||| || ||| || |||| |||||||| ||||    
32548235 ttaggtcctttaagttatttaattgtaacttttagatcccgaatagcttacatttttaagatttaaaataccgcaaattgttacggttaaataactta 32548138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 648 - 704
Target Start/End: Complemental strand, 7202356 - 7202300
Alignment:
648 ccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaa 704  Q
    ||||| ||||| ||||||||||| |||||||||||| ||||||| ||||||||||||    
7202356 ccaacatgttacaattaattaacataaaggacctaaatggtacgaaaaaaacttaaa 7202300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 505 - 588
Target Start/End: Original strand, 33547849 - 33547933
Alignment:
505 tttttcataacacttaggtcgtttaagttatttaattgtaac-tttaggtcccgaataacttgcagttttaagatctgaaatccc 588  Q
    ||||||||| || ||||||| ||||||||||||||||||||| |||| ||  ||||||||||  | ||||||| |||||||||||    
33547849 tttttcataccatttaggtcctttaagttatttaattgtaacttttaagtttcgaataacttaaatttttaaggtctgaaatccc 33547933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 427 - 466
Target Start/End: Original strand, 17411092 - 17411131
Alignment:
427 cacttacgtcatttaagttatttaattataacaagttagt 466  Q
    ||||||||||||||||||||||||||| ||||||||||||    
17411092 cacttacgtcatttaagttatttaattgtaacaagttagt 17411131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 35; E-Value: 0.0000000005
Query Start/End: Original strand, 527 - 632
Target Start/End: Complemental strand, 7202419 - 7202313
Alignment:
527 ttaagttatttaattgtaac-tttaggtcccgaataacttgcagttttaagatctgaaatccctcaatttcttacagttaaatagcttagaggacctaat 625  Q
    |||||||||||||||||||| |||||| ||||||||||||  | ||||||||||| ||||| | |||  | ||||| |||| || | || |||||||||     
7202419 ttaagttatttaattgtaacttttaggccccgaataacttaaatttttaagatctaaaatctcccaacatgttacaattaattaacataaaggacctaaa 7202320  T
626 tggtacg 632  Q
    |||||||    
7202319 tggtacg 7202313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 35; E-Value: 0.0000000005
Query Start/End: Original strand, 507 - 580
Target Start/End: Original strand, 10544136 - 10544210
Alignment:
507 tttcataacacttaggtcgtttaagttatttaattgtaac-tttaggtcccgaataacttgcagttttaagatct 580  Q
    |||| ||||||||||||| ||||||||| ||||||||||| ||||||||  |||||| || || |||||||||||    
10544136 tttcgtaacacttaggtcatttaagttagttaattgtaacttttaggtcttgaataatttacatttttaagatct 10544210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 526 - 626
Target Start/End: Complemental strand, 29693383 - 29693282
Alignment:
526 tttaagttatttaattgtaacttt-aggtcccgaataacttgcagttttaagatctgaaatccctcaatttcttacagttaaatagcttagaggacctaa 624  Q
    ||||| ||||||||| |||||||| ||| |||||||||||| || ||||||||||| ||||| |  || || |||||||| |||| |||| || ||||||    
29693383 tttaaattatttaatcgtaacttttaggacccgaataacttacatttttaagatctaaaatcgcctaaattattacagttcaataacttaaagaacctaa 29693284  T
625 tt 626  Q
    ||    
29693283 tt 29693282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 640 - 737
Target Start/End: Complemental strand, 31314609 - 31314513
Alignment:
640 ttaaaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaag 737  Q
    ||||| ||| || ||||||||||||| |||||||||  || |||||| |||  ||||||||||||||||||| || ||| || ||||||||| |||||    
31314609 ttaaatgactaatttgttataattaaataacttaaaa-acataagtgatactgaaaaaacttaaatgatcaacttgttataattaaataactcaaaag 31314513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 515 - 609
Target Start/End: Complemental strand, 9405362 - 9405267
Alignment:
515 cacttaggtcgtttaagttatttaattgtaactt-taggtcccgaataacttgcagttttaagatctgaaatccctcaatttcttacagttaaata 609  Q
    ||||||| || |||||||||||||||||||| || ||  | ||||||||||   | |||||||||||||||| |||||| || |||| ||||||||    
9405362 cacttagatcctttaagttatttaattgtaatttataaatgccgaataactaaaatttttaagatctgaaattcctcaaattgttacggttaaata 9405267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 662 - 735
Target Start/End: Complemental strand, 196135 - 196063
Alignment:
662 ttaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaa 735  Q
    |||| ||||||||||||||||| || |||  ||||||||||||| |||||||| |||||| ||| ||| |||||    
196135 ttaagtaacttaaaggacctaattgatactgaaaaaacttaaat-atcaatttgttacaattaattaatttaaa 196063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 640 - 681
Target Start/End: Complemental strand, 33547785 - 33547744
Alignment:
640 ttaaaggaccaacttgttataattaattaacttaaaggacct 681  Q
    |||||||||||| |||||| |||||| |||||||||||||||    
33547785 ttaaaggaccaatttgttacaattaaataacttaaaggacct 33547744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 84; Significance: 3e-39; HSPs: 23)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 84; E-Value: 3e-39
Query Start/End: Original strand, 484 - 754
Target Start/End: Original strand, 41331168 - 41331439
Alignment:
484 aacaagttagttatgtaagtatttttcataacacttaggtcgtttaagttatttaattgtaacttt-aggtcccgaataacttgcagttttaagatctga 582  Q
    |||||||||||  | ||| ||||||||||| |||||||||| |||||||||||||||| ||||||| ||||  ||||||||||  | ||||| |||||      
41331168 aacaagttagtagtttaaatatttttcatagcacttaggtc-tttaagttatttaattataacttttaggtatcgaataacttcaatttttaggatctag 41331266  T
583 aatccctcaatttcttacagttaaatagcttagaggacctaattggtacgnnnnnnn-ttaaaggaccaacttgttataattaattaacttaaaggacct 681  Q
    ||||||  || || |||| |||||||| |||| | ||||| ||||||||         |||||| ||||||||||||||||| ||||||||||| || ||    
41331267 aatccccaaaattgttacggttaaataacttaaatgacctcattggtacatgaaaaacttaaagaaccaacttgttataatttattaacttaaatgagct 41331366  T
682 aagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaagacttatggtgtaattta 754  Q
    | ||||||||  ||||||||||||||||||||| |||||| ||||||||||||| |||||||| | |||||||    
41331367 aggtggtacgagaaaaacttaaatgatcaatttattacaattaaataacttaaatgacttatgatataattta 41331439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 58; E-Value: 9e-24
Query Start/End: Original strand, 499 - 754
Target Start/End: Original strand, 18128375 - 18128632
Alignment:
499 taagtatttttcataacacttaggtcgtttaagttatttaattgtaactttaggtccc-gaataacttgcagttttaagatctgaaatccctcaatttct 597  Q
    |||||||| ||| |||||||||| || ||||| || |||||||||||||||    ||  ||||||||| || |||||||||||||||| |  ||| || |    
18128375 taagtattcttcgtaacacttagatcctttaaattttttaattgtaacttttaaaccttgaataacttacatttttaagatctgaaattcgccaaattgt 18128474  T
598 tacagttaaatagcttagaggacctaattggtacgnnnnnnn-ttaaaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaa 696  Q
    ||  |||||||| |||| |||| |||||| |||||        |||||| |||||||| ||| ||||||||||||||||| |||||||| ||||| ||||    
18128475 tatggttaaataacttaaaggatctaattcgtacgaaaaaaaattaaagcaccaacttattacaattaattaacttaaagaacctaagtagtacg-aaaa 18128573  T
697 aactt-aaatgatcaatttcttacaactaaataacttaaaagacttatggtgtaattta 754  Q
    ||||| ||| || |||||| |||||  ||||||| ||||| ||| ||||||||||||||    
18128574 aacttaaaaggaccaatttattacatttaaataatttaaaggacctatggtgtaattta 18128632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 58; E-Value: 9e-24
Query Start/End: Original strand, 643 - 736
Target Start/End: Original strand, 30551947 - 30552040
Alignment:
643 aaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaa 736  Q
    |||||||||||||||| |||| ||||||||||| ||||||||||||||  |||||||||||| || |||||| |||||| ||||||||||||||    
30551947 aaggaccaacttgttacaattgattaacttaaatgacctaagtggtaccaaaaaaacttaaaggaccaatttattacaattaaataacttaaaa 30552040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 643 - 736
Target Start/End: Original strand, 6589558 - 6589651
Alignment:
643 aaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaa 736  Q
    |||||||||||| ||| |||| ||||||||||| ||||||||||||||  |||||||||||| ||||||||| |||||| ||||| ||||||||    
6589558 aaggaccaacttattacaattgattaacttaaatgacctaagtggtaccaaaaaaacttaaaggatcaatttattacaattaaattacttaaaa 6589651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 660 - 739
Target Start/End: Complemental strand, 12422123 - 12422044
Alignment:
660 aattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaagac 739  Q
    |||||||| ||||||||||||||||||||| | ||||||||||||||| |||||| |||||| | |||||||||||||||    
12422123 aattaatttacttaaaggacctaagtggtatgaaaaaaacttaaatgaccaatttattacaatttaataacttaaaagac 12422044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 649 - 756
Target Start/End: Original strand, 32804629 - 32804736
Alignment:
649 caacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaagacttatggtgt 748  Q
    |||||||||  |||||||||||||||| ||| ||||| ||| | ||||||| |||| ||||||||| |||||| |||||| | |||||||||| ||||||    
32804629 caacttgttgcaattaattaacttaaatgacttaagttgtatgaaaaaaacctaaaagatcaatttattacaattaaatatcctaaaagacttgtggtgt 32804728  T
749 aatttaac 756  Q
    ||||||||    
32804729 aatttaac 32804736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 647 - 735
Target Start/End: Complemental strand, 1532285 - 1532197
Alignment:
647 accaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaa 735  Q
    |||||||||||||| |||| |||||||||||||||||| |||||  ||||||  ||||||||||| || |||||| |||||||||||||    
1532285 accaacttgttatagttaaataacttaaaggacctaagaggtacaaaaaaaatgtaaatgatcaacttattacaattaaataacttaaa 1532197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 45; E-Value: 5e-16
Query Start/End: Original strand, 558 - 746
Target Start/End: Complemental strand, 20389822 - 20389633
Alignment:
558 aataacttgcagttttaagatctgaaatccctcaatttcttacagttaaatagcttagaggacctaattggtacgnnnnnnnttaaaggaccaacttgtt 657  Q
    |||||||| || ||||||||||| |||| |  ||| || ||||||||||||| |||| |||| |||||| |||||        | || ||||||||||||    
20389822 aataacttacatttttaagatctaaaattcgccaaattgttacagttaaataacttaaaggatctaattcgtacgaaaaaaacttaaagaccaacttgtt 20389723  T
658 ataattaattaacttaaaggacctaagtggtacg-taaaaaacttaaatgatcaatttcttacaactaaataacttaaaagacttatggt 746  Q
    | ||||||||||||||||| | |||||| |||||  ||||||||||||  |  | ||| |||||  ||||||||||||||||| ||||||    
20389722 acaattaattaacttaaagcatctaagtagtacgaaaaaaaacttaaagaactactttgttacatttaaataacttaaaagacctatggt 20389633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 640 - 735
Target Start/End: Original strand, 28003341 - 28003434
Alignment:
640 ttaaaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaa 735  Q
    |||||||| |||||||||| | |||||||||||||||||||||| ||||||| ||||||||| || |||||| || |||||| ||||||| |||||    
28003341 ttaaaggatcaacttgttacatttaattaacttaaaggacctaattggtacg-aaaaaactt-aacgatcaacttgttacaattaaataatttaaa 28003434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 40; E-Value: 0.0000000000005
Query Start/End: Original strand, 499 - 585
Target Start/End: Original strand, 48447315 - 48447402
Alignment:
499 taagtatttttcataacacttaggtcgtttaagttatttaattgtaac-tttaggtcccgaataacttgcagttttaagatctgaaat 585  Q
    |||||||||||| |||| |||||||| ||||||||||||||||||||| |||| | ||  |||||||| || ||||||||||| ||||    
48447315 taagtatttttcgtaacgcttaggtcctttaagttatttaattgtaacttttatgcccaaaataacttacatttttaagatctaaaat 48447402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 642 - 735
Target Start/End: Complemental strand, 5755685 - 5755594
Alignment:
642 aaaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaa 735  Q
    ||||||||||||||||| ||||||||||| |||| ||  |||||||||||  ||||| ||||| |  |||||| |||||| |||||||||||||    
5755685 aaaggaccaacttgttacaattaattaacataaatgatttaagtggtacg--aaaaaattaaagggccaatttgttacaattaaataacttaaa 5755594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 38; E-Value: 0.000000000008
Query Start/End: Original strand, 499 - 588
Target Start/End: Original strand, 12264801 - 12264890
Alignment:
499 taagtatttttcataacacttaggtcgtttaagttatttaattgtaactttaggtcccgaataacttgcagttttaagatctgaaatccc 588  Q
    |||||||||||| || |||||||||| || ||||||||||| ||||||||| || |  ||||||||| || ||| ||||| |||||||||    
12264801 taagtatttttcgtaccacttaggtctttcaagttatttaagtgtaacttttggccatgaataacttacattttaaagatttgaaatccc 12264890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 499 - 578
Target Start/End: Complemental strand, 12422342 - 12422262
Alignment:
499 taagtatttttcataacacttaggtcgtttaagttatttaattgtaac-tttaggtcccgaataacttgcagttttaagat 578  Q
    |||||||| ||  |||||||||  || ||||||||||||||||||||| |||||||||||||||||||  | |||||||||    
12422342 taagtattgtttgtaacacttaaatcctttaagttatttaattgtaacttttaggtcccgaataacttatacttttaagat 12422262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 652 - 756
Target Start/End: Original strand, 12422352 - 12422455
Alignment:
652 cttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaagacttatggtgtaat 751  Q
    ||||||| |||||| ||||||||| ||| |||||| |||  |||||||||||| ||| ||||| |||||| |||||||||||||  | ||  ||||||||    
12422352 cttgttaaaattaaataacttaaaagacgtaagtgataca-aaaaaacttaaaggatgaatttgttacaattaaataacttaaagaaattccggtgtaat 12422450  T
752 ttaac 756  Q
    |||||    
12422451 ttaac 12422455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 556 - 756
Target Start/End: Original strand, 21920965 - 21921164
Alignment:
556 cgaataacttgcagttttaagatctgaaatccctcaatttcttacagttaaatagcttagaggacctaattggtacgnnnnnnn-ttaaaggaccaactt 654  Q
    |||||||||| || ||||||| ||| |||| || ||| || |||  |||||||| |||| ||||||||||| |||||        |||||  | ||||||    
21920965 cgaataacttacatttttaaggtctaaaattccccaaatttttatggttaaataacttaaaggacctaattagtacggaaaaaacttaaataaacaactt 21921064  T
655 gttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaagacttatggtgtaattta 754  Q
    |||| | ||||||||||||||| || |||||||||   |||||||||||||||  ||||  ||| |  ||||||||||||| |||||||| |||||||||    
21921065 gttacagttaattaacttaaag-acataagtggtaaa-aaaaaacttaaatgacaaattagttatagttaaataacttaaatgacttatgatgtaattta 21921162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 499 - 550
Target Start/End: Original strand, 28002279 - 28002330
Alignment:
499 taagtatttttcataacacttaggtcgtttaagttatttaattgtaacttta 550  Q
    |||||| |||||||| |||||||||| |||||||| ||||||||||||||||    
28002279 taagtacttttcataccacttaggtcctttaagttgtttaattgtaacttta 28002330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 35; E-Value: 0.0000000005
Query Start/End: Original strand, 656 - 721
Target Start/End: Complemental strand, 32918595 - 32918529
Alignment:
656 ttataattaattaacttaaaggacctaagtggtacgtaa-aaaacttaaatgatcaatttcttacaa 721  Q
    ||||||||||||||||||||||| ||||||| |||| || |||||| ||| ||||||||| ||||||    
32918595 ttataattaattaacttaaaggagctaagtgatacgaaataaaactcaaaagatcaatttattacaa 32918529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 643 - 704
Target Start/End: Original strand, 1532441 - 1532501
Alignment:
643 aaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaa 704  Q
    |||||||||||||||| |||||| ||||||||||  | ||||||||||| ||||||||||||    
1532441 aaggaccaacttgttacaattaagtaacttaaagagcgtaagtggtacg-aaaaaacttaaa 1532501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 660 - 736
Target Start/End: Complemental strand, 6586938 - 6586862
Alignment:
660 aattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaa 736  Q
    |||| ||||||||||| ||||||||| ||||  |||||| ||||  ||||||||| |||||| ||||| ||||||||    
6586938 aattgattaacttaaatgacctaagtagtaccaaaaaaatttaagagatcaatttattacaattaaattacttaaaa 6586862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 505 - 545
Target Start/End: Original strand, 32857850 - 32857890
Alignment:
505 tttttcataacacttaggtcgtttaagttatttaattgtaa 545  Q
    |||||| ||||||||||||| ||||||||||||||||||||    
32857850 tttttcgtaacacttaggtcttttaagttatttaattgtaa 32857890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 807 - 842
Target Start/End: Complemental strand, 21595162 - 21595127
Alignment:
807 atttctttaaatttataattttttcaaagtttgtta 842  Q
    ||||||||||||| ||||||||||||||||||||||    
21595162 atttctttaaattcataattttttcaaagtttgtta 21595127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 655 - 734
Target Start/End: Complemental strand, 48447362 - 48447283
Alignment:
655 gttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaa 734  Q
    |||| |||||| |||||||||||||||||| | |||| |||| |||||||  |  ||||| |||||| ||||||||||||    
48447362 gttacaattaaataacttaaaggacctaagcgttacgaaaaatacttaaagtactaatttgttacaattaaataacttaa 48447283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 641 - 698
Target Start/End: Complemental strand, 5762753 - 5762696
Alignment:
641 taaaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaa 698  Q
    ||||| |||||||||||| ||||||||||| || |  |||||||||||||| ||||||    
5762753 taaagaaccaacttgttacaattaattaacatatattacctaagtggtacggaaaaaa 5762696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0591 (Bit Score: 66; Significance: 1e-28; HSPs: 1)
Name: scaffold0591
Description:

Target: scaffold0591; HSP #1
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 618 - 756
Target Start/End: Original strand, 3866 - 4003
Alignment:
618 gacctaattggtacgnnnnnnnttaaaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttctt 717  Q
    |||||||||||||||       ||||||||||||||||||| ||| ||||||||||||| |||| ||||||| | ||| |||||||||||||||||| ||    
3866 gacctaattggtacgaaaaaacttaaaggaccaacttgttacaatcaattaacttaaag-acctcagtggtaggaaaataacttaaatgatcaatttatt 3964  T
718 acaactaaataacttaaaagacttatggtgtaatttaac 756  Q
    |||| |||||||| |||| ||||| ||||||||||||||    
3965 acaattaaataacataaatgacttctggtgtaatttaac 4003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 63; Significance: 9e-27; HSPs: 19)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 63; E-Value: 9e-27
Query Start/End: Original strand, 649 - 735
Target Start/End: Original strand, 2277209 - 2277295
Alignment:
649 caacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaa 735  Q
    |||||||||| |||||||||||||||||||||||||||||||  |||||||||||| ||||||||| |||||| |||||||||||||    
2277209 caacttgttacaattaattaacttaaaggacctaagtggtacaaaaaaaacttaaaggatcaatttgttacaattaaataacttaaa 2277295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 57; E-Value: 3e-23
Query Start/End: Original strand, 656 - 736
Target Start/End: Complemental strand, 27533069 - 27532989
Alignment:
656 ttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaa 736  Q
    |||||||||| ||||||||||||| |||||||||| ||||||||||||| ||||||||| |||||| ||||||||||||||    
27533069 ttataattaaataacttaaaggacgtaagtggtacataaaaaacttaaaagatcaatttattacaattaaataacttaaaa 27532989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 56; E-Value: 1e-22
Query Start/End: Original strand, 640 - 719
Target Start/End: Original strand, 37064689 - 37064768
Alignment:
640 ttaaaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttac 719  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||| || ||||||||||| |||| ||||| ||||    
37064689 ttaaaggaccaacttgttataattaattaacttaaaggacttaagtggtgcgaaaaaaacttaattgattaatttattac 37064768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 652 - 754
Target Start/End: Complemental strand, 15907790 - 15907689
Alignment:
652 cttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaagacttatggtgtaat 751  Q
    ||||||||||||||||||||||||| |  ||||||||||| |||||||||||| || |||||| | |||| ||||||||||||| || || |||||||||    
15907790 cttgttataattaattaacttaaagaatataagtggtacgaaaaaaacttaaa-gaccaatttatcacaagtaaataacttaaaggatttctggtgtaat 15907692  T
752 tta 754  Q
    |||    
15907691 tta 15907689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 640 - 754
Target Start/End: Original strand, 15907944 - 15908058
Alignment:
640 ttaaaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaagac 739  Q
    |||||||| |||||||||||||||||||||| ||||  |||||||||||| | ||||||||||||| |  ||||| |||||  |||||| |||||| ||     
15907944 ttaaaggatcaacttgttataattaattaacctaaaaaacctaagtggtatgaaaaaaacttaaataactaatttattacagttaaatatcttaaaggat 15908043  T
740 ttatggtgtaattta 754  Q
    || ||||||||||||    
15908044 ttttggtgtaattta 15908058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 484 - 736
Target Start/End: Complemental strand, 2510263 - 2510015
Alignment:
484 aacaagttagttatgtaagtatttttcataacacttaggtcgtttaagttatttaattgtaactttaggtcc-cgaataacttgcagttttaagatctga 582  Q
    |||||||||||| | ||| |||||||  |||||||||| || |||||||||||||| ||||| |||  | || |||||||||| || |||||| || |||    
2510263 aacaagttagttctttaattattttttgtaacacttagctcctttaagttatttaagtgtaatttttagaccacgaataacttacatttttaaaatatga 2510164  T
583 aatccctcaatttcttacagttaaatagcttagaggacctaattggtacgnnnnnnnttaaaggaccaacttgttataattaattaacttaaaggaccta 682  Q
    |||| ||||| || || || |||| || |||| |||| |||||| |||||       |||||||| ||| |||||  |||||||||||||    ||||||    
2510163 aatctctcaaattgttgcaattaagtaacttaaaggatctaatttgtacggaaaaacttaaaggaacaatttgttgcaattaattaactt----gaccta 2510068  T
683 agtggtacgtaaaaaa-cttaaatgatcaatttcttacaactaaataacttaaaa 736  Q
    ||||||| | |||||| | ||||  | |||||| |||||| ||||||||||||||    
2510067 agtggtatgaaaaaaaacataaa--accaatttattacaattaaataacttaaaa 2510015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 43; E-Value: 0.000000000000008
Query Start/End: Original strand, 672 - 754
Target Start/End: Original strand, 12807666 - 12807748
Alignment:
672 taaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaagacttatggtgtaattta 754  Q
    |||||||||||||||||| |||||||| |||||  |||||||| | |||| ||||||||||||||||  | ||||||||||||    
12807666 taaaggacctaagtggtatgtaaaaaatttaaaaaatcaatttataacaattaaataacttaaaagatctctggtgtaattta 12807748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 484 - 614
Target Start/End: Original strand, 3806871 - 3807000
Alignment:
484 aacaagttagttatgtaagtatttttcataacacttaggtcgtttaagttatttaattgtaactttaggtcccgaataacttgcagttttaagatctgaa 583  Q
    ||||||||||| || |||||||||||| || |||||||||| ||| | |||||||||| ||| |||  | || || |||||| || ||||||||| ||||    
3806871 aacaagttagtcatttaagtatttttcgtagcacttaggtccttttaattatttaattataatttttagccctgagtaacttacatttttaagatatgaa 3806970  T
584 atccctcaatttcttacagttaaatagctta 614  Q
    ||  ||||| || ||||||||||||| ||||    
3806971 atatctcaa-ttgttacagttaaataactta 3807000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 35; E-Value: 0.0000000005
Query Start/End: Original strand, 427 - 469
Target Start/End: Original strand, 18080603 - 18080645
Alignment:
427 cacttacgtcatttaagttatttaattataacaagttagttat 469  Q
    ||||||||||||||||||||||||||| ||| |||||||||||    
18080603 cacttacgtcatttaagttatttaattgtaataagttagttat 18080645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 643 - 739
Target Start/End: Original strand, 32566875 - 32566969
Alignment:
643 aaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaagac 739  Q
    |||||| | ||||||| ||||||| |||||||| ||||||| | |||| |||||  | |||| ||||||||||||| ||  ||||||||||||||||    
32566875 aaggactagcttgttacaattaataaacttaaatgacctaaatagtacataaaa--cctaaaggatcaatttcttataataaaataacttaaaagac 32566969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 649 - 737
Target Start/End: Original strand, 2967707 - 2967794
Alignment:
649 caacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaag 737  Q
    ||||||||||||||||||||| |||||||| |||||| | | | ||||||||||||  | |||||| |||  | |||||||||||||||    
2967707 caacttgttataattaattaatttaaaggatctaagtagaaggaaaaaaacttaaa-aaacaatttgttaggattaaataacttaaaag 2967794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 640 - 735
Target Start/End: Original strand, 3806998 - 3807091
Alignment:
640 ttaaaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaa 735  Q
    |||||| || ||||||||| |||||||||||||||| ||| ||||| |||  ||||||||||| | || |||||| |||| | ||||||| |||||    
3806998 ttaaagtactaacttgttaaaattaattaacttaaaagacataagttgta--taaaaaacttagaggaccaatttgttactattaaataatttaaa 3807091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 499 - 631
Target Start/End: Complemental strand, 12190002 - 12189869
Alignment:
499 taagtatttttcataacacttaggtcgtttaagttatttaattgtaacttt-aggtcccgaataacttgcagttttaagatctgaaatccc-tcaatttc 596  Q
    ||||||||||   ||||||||||||  ||||| |||||||||||||||||| ||  ||| |||| ||| |  ||| |||||||||||| || | |||||     
12190002 taagtattttctgtaacacttaggttctttaatttatttaattgtaacttttagacccctaatatcttacgttttcaagatctgaaattccgttaatttg 12189903  T
597 ttacagttaaatagcttagaggacctaattggtac 631  Q
    | ||||||||||| |||| | ||||||||||||||    
12189902 t-acagttaaataacttaaatgacctaattggtac 12189869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 499 - 631
Target Start/End: Complemental strand, 12434430 - 12434297
Alignment:
499 taagtatttttcataacacttaggtcgtttaagttatttaattgtaacttt-aggtcccgaataacttgcagttttaagatctgaaatccc-tcaatttc 596  Q
    ||||||||||   ||||||||||||  ||||| |||||||||||||||||| ||  ||| |||| ||| |  ||| |||||||||||| || | |||||     
12434430 taagtattttctgtaacacttaggttctttaatttatttaattgtaacttttagacccctaatatcttacgttttcaagatctgaaattccgttaatttg 12434331  T
597 ttacagttaaatagcttagaggacctaattggtac 631  Q
    | ||||||||||| |||| | ||||||||||||||    
12434330 t-acagttaaataacttaaatgacctaattggtac 12434297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 423 - 457
Target Start/End: Original strand, 27533035 - 27533069
Alignment:
423 gtaccacttacgtcatttaagttatttaattataa 457  Q
    |||||||||||||| ||||||||||||||||||||    
27533035 gtaccacttacgtcctttaagttatttaattataa 27533069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 649 - 719
Target Start/End: Original strand, 45445141 - 45445210
Alignment:
649 caacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttac 719  Q
    ||||||||||| ||||| ||| ||| ||||||||| ||||||| |||||||||||| || |||||| ||||    
45445141 caacttgttatgattaaataatttacaggacctaattggtacg-aaaaaacttaaacgaccaatttattac 45445210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 666 - 758
Target Start/End: Original strand, 41123 - 41216
Alignment:
666 ttaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaaga-cttatggtgtaatttaacat 758  Q
    ||||||||||  || ||||||||||  |||||||||||| ||  ||||| |||||| ||||||| ||||| || ||  ||||||||||||||||    
41123 ttaacttaaataacataagtggtacacaaaaaacttaaaggactaatttgttacaattaaataatttaaaggatctcttggtgtaatttaacat 41216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 485 - 549
Target Start/End: Original strand, 8453098 - 8453163
Alignment:
485 acaagttagttatgtaagtatttttcataacacttaggt-cgtttaagttatttaattgtaacttt 549  Q
    |||||||||| || ||||||||| ||||||||||||  | | |||||||||||| |||||||||||    
8453098 acaagttagtcatttaagtatttctcataacacttacatccttttaagttatttgattgtaacttt 8453163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 662 - 707
Target Start/End: Complemental strand, 32566769 - 32566724
Alignment:
662 ttaattaacttaaaggacctaagtggtacgtaaaaaacttaaatga 707  Q
    |||| ||||||||||||| ||||||| ||| |||||||||||||||    
32566769 ttaaataacttaaaggacttaagtggcacgaaaaaaacttaaatga 32566724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 59; Significance: 2e-24; HSPs: 22)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 59; E-Value: 2e-24
Query Start/End: Original strand, 499 - 735
Target Start/End: Complemental strand, 363853 - 363615
Alignment:
499 taagtatttttcataacacttaggtcgtttaagttatttaattgtaac-tttaggtcccgaataacttgcagttttaagatctgaaat-ccctcaatttc 596  Q
    |||||||||||| |||  |||| ||| |||||||| |||||||||||| |||||| || ||||||||| || ||||||||||| |||| |||  || ||     
363853 taagtatttttcgtaatgcttaagtcatttaagttgtttaattgtaacttttaggcccagaataacttacatttttaagatctaaaatacccaaaaattg 363754  T
597 ttacagttaaatagcttagaggacctaattggtacgnnnnnnnttaaaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaa 696  Q
    |||| |||||||| |||| | ||||||||| |||||       ||||| ||||||||||||| ||||||||||| ||||| ||||||||| |||  ||||    
363753 ttacggttaaataacttaaatgacctaattagtacgaaaaaacttaaa-gaccaacttgttacaattaattaacataaagaacctaagtgatacaaaaaa 363655  T
697 a-acttaaatgatcaatttcttacaactaaataacttaaa 735  Q
    | |||||||  | | |||| |||||| |||||||||||||    
363654 agacttaaagaacctatttattacaattaaataacttaaa 363615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 57; E-Value: 3e-23
Query Start/End: Original strand, 499 - 734
Target Start/End: Original strand, 47726457 - 47726693
Alignment:
499 taagtatttttcataacacttaggtcgtttaagttatttaattgtaac-tttaggtcccgaataacttgcagttttaagatctgaaatccctcaatttct 597  Q
    |||||||| ||  ||||||||||||  ||||||||||||||||||||| ||||| |||||||||||||||| ||||||||| |||||| |||||| || |    
47726457 taagtattgtttgtaacacttaggtgctttaagttatttaattgtaacttttagatcccgaataacttgcatttttaagatatgaaattcctcaaattgt 47726556  T
598 tacagttaaatagcttagaggacctaattggtac-gnnnnnnnttaaaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaa 696  Q
    ||  || ||||| |  | |||||||  |||||||         ||||||||||| ||||||  |  ||||||||||||| |||||||||| || | ||||    
47726557 taaggtaaaataacacaaaggaccttgttggtacaagaaaaacttaaaggaccatcttgttcgagctaattaacttaaatgacctaagtgatatgaaaaa 47726656  T
697 aacttaaatgatcaatttcttacaactaaataacttaa 734  Q
    ||||||||| | |||||| ||||||  |||||||||||    
47726657 aacttaaat-accaatttattacaataaaataacttaa 47726693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 57; E-Value: 3e-23
Query Start/End: Original strand, 499 - 734
Target Start/End: Original strand, 47747763 - 47747999
Alignment:
499 taagtatttttcataacacttaggtcgtttaagttatttaattgtaac-tttaggtcccgaataacttgcagttttaagatctgaaatccctcaatttct 597  Q
    |||||||| ||  ||||||||||||  ||||||||||||||||||||| ||||| |||||||||||||||| ||||||||| |||||| |||||| || |    
47747763 taagtattgtttgtaacacttaggtgctttaagttatttaattgtaacttttagatcccgaataacttgcatttttaagatatgaaattcctcaaattgt 47747862  T
598 tacagttaaatagcttagaggacctaattggtac-gnnnnnnnttaaaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaa 696  Q
    ||  || ||||| |  | |||||||  |||||||         ||||||||||| ||||||  |  ||||||||||||| |||||||||| || | ||||    
47747863 taaggtaaaataacacaaaggaccttgttggtacaagaaaaacttaaaggaccatcttgttcgagctaattaacttaaatgacctaagtgatatgaaaaa 47747962  T
697 aacttaaatgatcaatttcttacaactaaataacttaa 734  Q
    ||||||||| | |||||| ||||||  |||||||||||    
47747963 aacttaaat-accaatttattacaataaaataacttaa 47747999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 643 - 736
Target Start/End: Complemental strand, 16554396 - 16554303
Alignment:
643 aaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaa 736  Q
    |||||||||||||||| |||| ||||||||||| ||| ||||||||||  |||||||||||| || |||||| |||||| ||||||||||||||    
16554396 aaggaccaacttgttacaattgattaacttaaatgacttaagtggtaccaaaaaaacttaaaggaccaatttattacaattaaataacttaaaa 16554303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 500 - 630
Target Start/End: Complemental strand, 29955000 - 29954870
Alignment:
500 aagtatttttcataacacttaggtcgtttaagttatttaattgtaactttaggtccc-gaataacttgcagttttaagatctgaaatccctcaatttctt 598  Q
    ||||||||| | || |||||||||| ||||||||||||||||||||||||  ||||| ||||||||| || ||||||||| |||||| |  ||| || ||    
29955000 aagtattttccgtaccacttaggtc-tttaagttatttaattgtaacttttagtcccagaataacttacatttttaagatatgaaattctccaaattatt 29954902  T
599 acagttaaatagcttagaggacctaattggta 630  Q
    || |||||||| |||| |||||||||||||||    
29954901 acggttaaataacttaaaggacctaattggta 29954870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 646 - 735
Target Start/End: Complemental strand, 18470279 - 18470189
Alignment:
646 gaccaacttgttataattaattaacttaaaggacctaagtggtacg-taaaaaacttaaatgatcaatttcttacaactaaataacttaaa 735  Q
    ||||||||||||| | |||| |||||||||||||||||| ||||||  ||||||| ||||||||||| || |||||| |||||||||||||    
18470279 gaccaacttgttacagttaaataacttaaaggacctaagaggtacgaaaaaaaacgtaaatgatcaacttattacaattaaataacttaaa 18470189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 640 - 735
Target Start/End: Original strand, 802251 - 802346
Alignment:
640 ttaaaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaa 735  Q
    ||||||||||||||||||| |||||||||| | ||||||  ||||||||||| |||||  ||||| || |||||| |||||  |||||||||||||    
802251 ttaaaggaccaacttgttacaattaattaattcaaaggatataagtggtacgaaaaaagtttaaaggaccaatttattacatttaaataacttaaa 802346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 647 - 754
Target Start/End: Original strand, 12656368 - 12656474
Alignment:
647 accaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaagacttatggt 746  Q
    |||||||| ||| ||||||||||||||||||   ||||||||||| |||||| |||||  |||||| | |||||| ||||||||||||| |||||  |||    
12656368 accaacttattacaattaattaacttaaagggtttaagtggtacg-aaaaaatttaaaaaatcaatatgttacaattaaataacttaaaggactttcggt 12656466  T
747 gtaattta 754  Q
    ||||||||    
12656467 gtaattta 12656474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 649 - 735
Target Start/End: Complemental strand, 16026194 - 16026108
Alignment:
649 caacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaa 735  Q
    |||||| ||| | |||| |||||||||||||||||| |||||| ||||||  |||||||| || || |||||| |||||||||||||    
16026194 caacttattacagttaaataacttaaaggacctaagaggtacgaaaaaaatgtaaatgattaacttattacaattaaataacttaaa 16026108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 560 - 756
Target Start/End: Original strand, 11016877 - 11017075
Alignment:
560 taacttgcagttttaagatctgaaatccctcaatttcttacagttaaatagcttagaggacctaattggtacgnnnnnnn--ttaaaggaccaacttgtt 657  Q
    |||||| || ||||||||| | ||||| ||||| || |||| ||||||||| ||| ||||||||||||| |||         |||||| | |||||||||    
11016877 taacttacatttttaagattttaaatctctcaaattgttacggttaaatagtttaaaggacctaattggaacgaaaaacaacttaaag-atcaacttgtt 11016975  T
658 ataattaattaacttaaaggacctaagtggtacgtaaaaaacttaa-atgatcaatttcttacaactaaataacttaaaagacttatggtgtaatttaac 756  Q
    | |||||| |||||||||  ||||||||| || | ||||||  ||| | ||| ||||| ||| || ||||||||||||| ||| ||| ||||||||||||    
11016976 acaattaaataacttaaaacacctaagtgatatgcaaaaaaaataagaagattaatttattataattaaataacttaaaggacatatagtgtaatttaac 11017075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 499 - 565
Target Start/End: Original strand, 26706207 - 26706274
Alignment:
499 taagtatttttcataacacttaggtcgtttaagttatttaattgtaac-tttaggtcccgaataactt 565  Q
    |||||| ||||| ||||||||||||  ||||||||||||||||||||| |||||| | ||||||||||    
26706207 taagtagttttcgtaacacttaggttctttaagttatttaattgtaacttttaggcctcgaataactt 26706274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 640 - 735
Target Start/End: Complemental strand, 46530258 - 46530163
Alignment:
640 ttaaaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaa 735  Q
    ||||||| | ||||||||| |||||||||||||||| |||||||||||| || |||| | |||||  | || ||| | |||| |||||||||||||    
46530258 ttaaagggcaaacttgttacaattaattaacttaaaagacctaagtggtgcgaaaaagaattaaagaaccagtttgtgacaattaaataacttaaa 46530163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 35; E-Value: 0.0000000005
Query Start/End: Original strand, 647 - 704
Target Start/End: Complemental strand, 48130268 - 48130213
Alignment:
647 accaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaa 704  Q
    |||||||||||| |||||||||||||||| || |||||||||||  ||||||||||||    
48130268 accaacttgttacaattaattaacttaaatgatctaagtggtac--aaaaaacttaaa 48130213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 652 - 741
Target Start/End: Original strand, 48130428 - 48130516
Alignment:
652 cttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaagactt 741  Q
    ||||||| || ||||||||||||| ||||||| |||||   | ||||||||||| |||||||| |||||| ||||||| ||||| |||||    
48130428 cttgttacaagtaattaacttaaaagacctaaatggtaaa-agaaaacttaaataatcaatttattacaattaaataatttaaaggactt 48130516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 655 - 754
Target Start/End: Original strand, 363806 - 363906
Alignment:
655 gttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaag-acttatggtgtaattt 753  Q
    |||| ||||||  |||||||| ||| ||||   |||| |||| ||||||||||  |||||||||||| ||||||||||||||| || | |||||||||||    
363806 gttacaattaaacaacttaaatgacttaagcattacgaaaaatacttaaatgacaaatttcttacaattaaataacttaaaagaacatctggtgtaattt 363905  T
754 a 754  Q
    |    
363906 a 363906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 640 - 719
Target Start/End: Original strand, 26706353 - 26706432
Alignment:
640 ttaaaggaccaacttgttataattaattaactt-aaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttac 719  Q
    ||||||||| ||||||| ||||||||||||||| ||||||| ||| || |||| ||||||||||||  |||||||| ||||    
26706353 ttaaaggacaaacttgtaataattaattaacttaaaaggacttaaatgatacg-aaaaaacttaaagaatcaatttattac 26706432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 33; E-Value: 0.000000007
Query Start/End: Original strand, 652 - 754
Target Start/End: Original strand, 46530411 - 46530517
Alignment:
652 cttgttataattaattaacttaaaggacctaagtggtacgtaaaaaa---cttaaat-gatcaatttcttacaactaaataacttaaaagacttatggtg 747  Q
    ||||||| |||||||||||||||| ||| | ||||||||| ||||||   ||||||  || |||||| |||||| ||||||||| ||| ||| | |||||    
46530411 cttgttacaattaattaacttaaatgacgtgagtggtacgaaaaaaaaaacttaaaaagagcaatttgttacaaataaataactaaaatgacatctggtg 46530510  T
748 taattta 754  Q
    |||||||    
46530511 taattta 46530517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 776 - 842
Target Start/End: Original strand, 2125101 - 2125168
Alignment:
776 tttttgtatggttcttaactaaact-acaaaaatttctttaaatttataattttttcaaagtttgtta 842  Q
    |||| |||||||||||||||||| | || |  |||| ||||||||||||||||| |||||||||||||    
2125101 ttttcgtatggttcttaactaaattcaccatgatttttttaaatttataattttctcaaagtttgtta 2125168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 499 - 545
Target Start/End: Complemental strand, 18470430 - 18470384
Alignment:
499 taagtatttttcataacacttaggtcgtttaagttatttaattgtaa 545  Q
    |||||||||||||||  |||||| || ||||||||||||||||||||    
18470430 taagtatttttcatacaacttagatcctttaagttatttaattgtaa 18470384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 643 - 704
Target Start/End: Original strand, 16026346 - 16026406
Alignment:
643 aaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaa 704  Q
    |||||||||||||||| |||||| ||||||||||  | ||||| ||||| ||||||||||||    
16026346 aaggaccaacttgttacaattaagtaacttaaagagcgtaagttgtacg-aaaaaacttaaa 16026406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 647 - 704
Target Start/End: Original strand, 18470439 - 18470495
Alignment:
647 accaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaa 704  Q
    |||||||||||| |||||| ||||||||||  | ||||||||||| ||||||||||||    
18470439 accaacttgttacaattaagtaacttaaagagcgtaagtggtacg-aaaaaacttaaa 18470495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 484 - 632
Target Start/End: Original strand, 47600499 - 47600648
Alignment:
484 aacaagttagttatgtaagtatttttcataacacttaggtcgtttaagttatttaattgtaac-tttaggtcccgaataacttgcagttttaagatctga 582  Q
    ||||| ||||| || |||||||||||| |||  |||||||| ||  |||| |||||||||||| |||||| ||| ||| ||||  | |||||| ||||||    
47600499 aacaaattagtcatttaagtatttttcgtaatgcttaggtctttcgagttgtttaattgtaacttttaggacccaaattacttcaatttttaacatctga 47600598  T
583 aatccctcaatttcttacagttaaatagcttagaggacctaattggtacg 632  Q
    ||| || |||  | ||||  ||||||| |||| | |||| ||||||||||    
47600599 aataccacaaacttttacgattaaataacttaaatgaccaaattggtacg 47600648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 53; Significance: 8e-21; HSPs: 8)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 53; E-Value: 8e-21
Query Start/End: Original strand, 496 - 731
Target Start/End: Complemental strand, 30534666 - 30534432
Alignment:
496 atgtaagtatttttcataacacttaggtcgtttaagttatttaattgtaactt-taggtcccgaataacttgcagttttaagatctgaaatccctcaatt 594  Q
    ||||||||||||||| ||| ||||||||| ||||| ||||||||||||||||| |||| ||| |||||||| || ||||||||||| |||   ||||| |    
30534666 atgtaagtatttttcgtaagacttaggtcttttaaattatttaattgtaacttgtaggccccaaataacttacatttttaagatctaaaacatctcaaat 30534567  T
595 tcttacagttaaatagcttagaggacctaattggtacgnnnnnnnttaaaggaccaacttgttataattaattaacttaaaggacctaagtggtac-gta 693  Q
    | ||||||||||||| |||| | || ||| ||||||||        | || || |||||| ||| ||||||||||| |||| |||||||| |||||   |    
30534566 tgttacagttaaataactta-aagagctagttggtacggaaaaaacttaaagagcaactttttacaattaattaacataaa-gacctaagcggtacaaaa 30534469  T
694 aaaaacttaaatgatcaatttcttacaactaaataact 731  Q
    ||||||||||| || |||||| |||||| |||||||||    
30534468 aaaaacttaaaagaccaattt-ttacaattaaataact 30534432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 499 - 735
Target Start/End: Original strand, 51265744 - 51265984
Alignment:
499 taagtatttttcataacacttaggtcgtttaagttatttaattgtaacttt-aggtcccgaataacttgcagttttaagatctgaaatccctcaatttct 597  Q
    |||||||||||||||  |||||| || |||||||||||||||||||| ||| | | |  ||| |||||  | ||||||||||||||||| ||||| || |    
51265744 taagtatttttcatacaacttagatcctttaagttatttaattgtaaatttcaagccttgaaaaacttaaatttttaagatctgaaatctctcaaattgt 51265843  T
598 tacagttaaatagcttagaggacctaattggtacgnnnnnnn---ttaaaggaccaacttgttataattaattaacttaaaggacctaagtggtacg-ta 693  Q
    ||| |||||||| |||| | ||| ||| || ||||          ||||  ||||||||||||||| |||| |||||||||||| ||||| ||||||  |    
51265844 tacggttaaataacttaaaagac-taagtgatacgggaaaaaaacttaacagaccaacttgttatagttaaataacttaaaggatctaagaggtacgaaa 51265942  T
694 aaaaacttaaatgatcaatttcttacaactaaataacttaaa 735  Q
    |||||| ||||||||||| || |||||| |||||||||||||    
51265943 aaaaacgtaaatgatcaacttattacaattaaataacttaaa 51265984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 547 - 704
Target Start/End: Complemental strand, 44291182 - 44291025
Alignment:
547 tttaggtcccgaataacttgcagttttaagatctgaaatccctcaatttcttacagttaaatagcttagaggacctaattggtacgnnnnnnn-ttaaag 645  Q
    ||||||||||||||||||| || ||||||||||| |||||||  || || |||| |||||||| |||| || ||||  ||||||||        |||||     
44291182 tttaggtcccgaataacttacatttttaagatctaaaatccccaaaattgttacggttaaataacttaaag-accttgttggtacggaaaaaacttaaaa 44291084  T
646 gaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaa 704  Q
    | ||||||||||| || ||||||||||||| ||| ||||||||||| ||||||||||||    
44291083 ggccaacttgttacaactaattaacttaaatgacttaagtggtacgaaaaaaacttaaa 44291025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 45; E-Value: 5e-16
Query Start/End: Original strand, 640 - 736
Target Start/End: Original strand, 44291413 - 44291509
Alignment:
640 ttaaaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaa 736  Q
    ||||||||| ||||||||| |||||| ||||||||||||| |||||| |||  |||||| ||| | || |||||| |||||| ||||||||||||||    
44291413 ttaaaggactaacttgttacaattaaataacttaaaggacataagtgatactaaaaaaatttagaggaccaatttgttacaattaaataacttaaaa 44291509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 650 - 754
Target Start/End: Original strand, 48200367 - 48200471
Alignment:
650 aacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaagacttatggtgta 749  Q
    ||||| ||| ||| |||||| ||||| ||| |||| |||||| |||||| ||||||||||||||  |||||| ||||||| |||||||| || | |||||    
48200367 aacttattacaatcaattaatttaaaagacttaagcggtacgaaaaaaaattaaatgatcaattctttacaattaaataagttaaaagatttctagtgta 48200466  T
750 attta 754  Q
    |||||    
48200467 attta 48200471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 643 - 704
Target Start/End: Complemental strand, 51265739 - 51265679
Alignment:
643 aaggaccaacttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaa 704  Q
    |||||||||||||||| |||||| ||||||||||  | ||||||||||| ||||||||||||    
51265739 aaggaccaacttgttacaattaagtaacttaaagagcgtaagtggtacg-aaaaaacttaaa 51265679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 499 - 565
Target Start/End: Original strand, 50898882 - 50898948
Alignment:
499 taagtatttttcataacacttaggtcgtttaagttatttaattgtaac-tttaggtcccgaataactt 565  Q
    |||||||||||| ||||||||||||  |||||||| |||||||||||| |||| ||| ||||||||||    
50898882 taagtatttttcgtaacacttaggt-atttaagttgtttaattgtaacttttacgtctcgaataactt 50898948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 653 - 754
Target Start/End: Original strand, 1662257 - 1662357
Alignment:
653 ttgttataattaattaacttaaaggacctaagtggtacgtaaaaaacttaaatgatcaatttcttacaactaaataacttaaaagacttatggtgtaatt 752  Q
    |||||| ||||||||||| ||| ||| ||||||||||   |||||||||||| ||||||||| || ||| ||||||  ||||| ||| | || |||||||    
1662257 ttgttacaattaattaacataatggatctaagtggtata-aaaaaacttaaaagatcaatttattgcaattaaatactttaaaggacctctgatgtaatt 1662355  T
753 ta 754  Q
    ||    
1662356 ta 1662357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 361696 times since January 2019
Visitors: 488