View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk89-1 (Length: 142)

Name: R108-tnk89-1
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk89-1
R108-tnk89-1
[»] chr4 (1 HSPs)
chr4 (9-142)||(39221699-39221834)
[»] chr5 (1 HSPs)
chr5 (7-142)||(5916207-5916344)
[»] chr1 (1 HSPs)
chr1 (7-142)||(19419618-19419755)


Alignment Details
Target: chr4 (Bit Score: 109; Significance: 3e-55; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 109; E-Value: 3e-55
Query Start/End: Original strand, 9 - 142
Target Start/End: Complemental strand, 39221834 - 39221699
Alignment:
9 tcttgagaaagctctttcccaattttgctccccaacttctcaagttattcgatgaaatcaatcatcttaagcacatggggtccaacttgatcattttcac 108  Q
    ||||||||||||||||||||||| |||| ||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||    
39221834 tcttgagaaagctctttcccaatattgcaccccaacttctcaagttgttcgatgagatcaatcatcttaagcacatggggtccaacttgatcattttcac 39221735  T
109 tcaatgaggacctgaac--agttttagacaactgat 142  Q
    |||||||||||||||||  |||||||||||||||||    
39221734 tcaatgaggacctgaacagagttttagacaactgat 39221699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 107; Significance: 5e-54; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 107; E-Value: 5e-54
Query Start/End: Original strand, 7 - 142
Target Start/End: Original strand, 5916207 - 5916344
Alignment:
7 agtcttgagaaagctctttcccaattttgctccccaacttctcaagttattcgatgaaatcaatcatcttaagcacatggggtccaacttgatcattttc 106  Q
    ||||||||||||||||||||||||| |||| ||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||    
5916207 agtcttgagaaagctctttcccaatattgcaccccaacttctcaagttgttcgatgagatcaatcatcttaagcacatggggtccaacttgatcattttc 5916306  T
107 actcaatgaggacctgaac--agttttagacaactgat 142  Q
    |||||||||||||||||||  |||||||||||| ||||    
5916307 actcaatgaggacctgaacagagttttagacaattgat 5916344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 107; Significance: 5e-54; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 107; E-Value: 5e-54
Query Start/End: Original strand, 7 - 142
Target Start/End: Complemental strand, 19419755 - 19419618
Alignment:
7 agtcttgagaaagctctttcccaattttgctccccaacttctcaagttattcgatgaaatcaatcatcttaagcacatggggtccaacttgatcattttc 106  Q
    ||||||||||||||||||||||||| |||| ||||||||||||||||| |||||||| |||||||||||||||||||||||| |||||||||||||||||    
19419755 agtcttgagaaagctctttcccaatattgcaccccaacttctcaagttgttcgatgagatcaatcatcttaagcacatggggaccaacttgatcattttc 19419656  T
107 actcaatgaggacctgaac--agttttagacaactgat 142  Q
    |||||||||||||||||||  |||||||||||||||||    
19419655 actcaatgaggacctgaacagagttttagacaactgat 19419618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108155 times since January 2019
Visitors: 1329